Detected as a riboswitch by 15 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA053702 Similarity: 0.986 Similarity: 0.985 Similarity: 0.985
UTR: 5HSAA053702
Gene: IQCF2
MFE: -11.050
ENS: 0.898
Length: 63.
Predicted Ligands:
fluoride - 16/20
unknown - 3/20
zmp-ztp - 1/20
 RS: URS0000C483A6_1736466
MFE: -16.231
Ligand: fluoride
Species: Pseudolabrys sp. Root1462 Fluoride riboswitch
 RS: URS0000BF25CA_187303
MFE: -16.446
Ligand: fluoride
Species: Methylocystis sp. SC2 Fluoride riboswitch
 RS: URS0000BFB4CD_980563
MFE: -25.132
Ligand: fluoride
Species: Methylosinus sp. R-45379 Fluoride riboswitch
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA053702 URS0000C483A6_1736466 URS0000BF25CA_187303 URS0000BFB4CD_980563
Length 63. 62. 62. 62.
Similarity - 0.986 0.985 0.985
Ensemble Norm 0.898 - - -
MFE -11.050 -16.231 -16.446 -25.132
Ligands - fluoride fluoride fluoride
Gene IQCF2 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 7. 10.001 10.004
Length SE - 1. 1. 1.
Lev Distance - 15. 16. 16.
UBS 6. 6. 6. 6.
BS 0. 0. 0. 0.
ILL 2. 1. 1. 1.
ILR 0. 2. 2. 2.
H 2. 2. 2. 2.
BL 2. 3. 3. 3.
BR 3. 2. 1. 1.
UN 0.190 0.194 0.226 0.129

Sequences

Field Description
UTR seq + 25 agagaaaucagggcuaaugaaccaucuaaggacaggccATGAGGGTTCGATTTTGTACCAAAG
UTR dot + 25 …….(((.((((..((..((……)).)))))).))).(((.((….)).)))….
RS 1 seq CCGCACGAUGGGGAUGGGGUCCCCCGAUAACCGCCGGAAUGGCUGAUGACUCCUGCCGGAUG
RS 1 dot …..((.(((..((.(((…))).))..))).))…((((.((….))..))))….
RS 2 seq UUAACGGAUGGGGAUGGGGUUCCCCCGAUAACCGCCGAAAGGCUGAUGACUCCUGCGAACUC
RS 2 dot ….(((.(((..((.(((….))).))..))))))….((.((….))..))……
RS 3 seq GUGCGGCCGGGGGAUGGGGUCCCCCUUCAACCGCCGCAAAGGCUGAUGACUCCUGCUGAUGU
RS 3 dot .(((((.(((..((.(((….))).))..))))))))..(((.((….))..)))…..

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table