Detected as a riboswitch by 15 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA053716 Similarity: 0.952 Similarity: 0.951 Similarity: 0.951
UTR: 5HSAA053716
Gene: IQCG
MFE: -37.427
ENS: 0.880
Length: 171.
Predicted Ligands:
FMN - 7/20
cobalamin - 7/20
Mg2+ - 4/20
RS: URS0002323DFC_568872
MFE: -85.768
Ligand: FMN
Species: Micromonospora sp. 211018 FMN riboswitch (RFN element)
RS: URS000231FD61_225345
MFE: -23.458
Ligand: cobalamin
Species: Clostridium chromoreductans Cobalamin riboswitch
RS: URS000231BD38_1487921
MFE: -29.692
Ligand: cobalamin
Species: Clostridium sp. HMP27 Cobalamin riboswitch
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA053716 URS0002323DFC_568872 URS000231FD61_225345 URS000231BD38_1487921
Length 171. 172. 173. 169.
Similarity - 0.952 0.951 0.951
Ensemble Norm 0.880 - - -
MFE -37.427 -85.768 -23.458 -29.692
Ligands - FMN cobalamin cobalamin
Gene IQCG - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 12.003 3.008 11.013
Length SE - 1. 4. 4.
Lev Distance - 56. 58. 54.
UBS 13. 13. 12. 12.
BS 0. 0. 0. 0.
ILL 2. 3. 1. 1.
ILR 4. 4. 4. 2.
H 3. 4. 3. 5.
BL 6. 3. 6. 5.
BR 4. 5. 3. 4.
UN 0.082 0.140 0.173 0.195

Sequences

Field Description
UTR seq + 25 aguuuacuuccugcguccccggacgccguagguggaaaggcgaacccugaguggaggauguucccgcugccuaaagaaugauugacuguaacugcacuuuugugagauuauaaauauaccacggaggguaacgaagcuacagaagaATGGAAGAAGACAGCCTGGAAGACT
UTR dot + 25 ..(((((((.(.(((((….))))).).)))))))..((.(((((((……)))..))))))((((.((………((..(((((.((((.((((((((……………))))))))))…..)).)))))..))……..)).))))……….
RS 1 seq ACGCGCUGGCGGGACUCGGUGUAAUUCCGAACCGGCGGUGAUCCACGGCCCGACCGUGGUAAGCCCGCGACCCGGUCGGCCCUGCCGCCCGGUGGACCUGGUGAGAAUCCGGGGCCGACGGUUGGGAGCGGGCCAACCCACUCCCAGACAGUCCGGAUGGGAGACAGCGCGC
RS 1 dot …(((((.(((…((((…….)))).))).)))))..((((((…..))))))…((((((..(((.(((((((((((((((.((….)).)))).)….)))))))))).)..))..))))))…….((((((..(…..)..))))))………
RS 2 seq AUUUAAAUUUAUGAAGUAAUUUUAAUUAAUUAAAAGGGAAUUAGGUGAAAUUCCUAAACUAUCCCGUAGCUGUAUUAGAGGAGCUUAAGUACAUUAUGUCACUUUUAAUUAGGGAAGACGUACUUAAAUUAUGAUUCUUAAGUCAGAAGACCUGCCUAUAUUUUGCACCAUUA
RS 2 dot ..(((((.((((…)))).)))))……….((((.(((((…….)))))….))))(((((((.(((.(((((.(((((((((…..(((.(((……)))…)))))))))))…..).))))).))))))…..))))………………
RS 3 seq AAUUGAUAUAUAGUUAUAGGUUAUGAAUUAAAAGGGAAGUCAGGUGAAAAUCCUGCACGGUCUCGCCGCUGUAAAAGAGGAGUCUUUAUAUAAUACCACUGGGAAACUGGGAAGGUUAUAAAGGCGAUGAUACUUAAGUCAGAAUACCUGCCUAUAAUAAUACACAAUU
RS 3 dot ..(((((.(((((…….))))).)))))..((((.((((((…….)))).))..)))).((.((…..)).)).(((((((((….(((.((((….))))…))))))))))))………..((.(((…..))).))…………….

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table