Detected as a riboswitch by 20 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA053773 Similarity: 0.970 Similarity: 0.969 Similarity: 0.969
UTR: 5HSAA053773
Gene: IQUB
MFE: -28.813
ENS: 0.955
Length: 122.
Predicted Ligands:
TPP - 16/20
guanidine - 1/20
cobalamin - 1/20
 RS: URS0000C2C972_1191298
MFE: -34.898
Ligand: TPP
Species: Vibrio genomosp. F6 str. FF-238 TPP riboswitch (THI element)
 RS: URS0000D7C58D_299255
MFE: -43.415
Ligand: TPP
Species: Ferrimonas marina TPP riboswitch (THI element)
 RS: URS0000BED210_1283841
MFE: -33.640
Ligand: TPP
Species: Stachybotrys chlorohalonata IBT 40285 TPP riboswitch (THI element)
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA053773 URS0000C2C972_1191298 URS0000D7C58D_299255 URS0000BED210_1283841
Length 122. 121. 121. 122.
Similarity - 0.970 0.969 0.969
Ensemble Norm 0.955 - - -
MFE -28.813 -34.898 -43.415 -33.640
Ligands - TPP TPP TPP
Gene IQUB - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 7.002 11. 10.
Length SE - 1. 1. 0.
Lev Distance - 36. 36. 38.
UBS 9. 8. 9. 10.
BS 0. 0. 0. 0.
ILL 4. 4. 2. 2.
ILR 5. 3. 3. 5.
H 2. 2. 3. 2.
BL 3. 2. 2. 4.
BR 1. 2. 2. 3.
UN 0.107 0.149 0.124 0.098

Sequences

Field Description
UTR seq + 25 acgaccaacagcugagaacgcggcgaguauggaagcugcgucuuaggagccugggaaagcacuucgacgagaauaguuugguuucguacacaggaaaATGTCTAATCAACAGGAGAAGTATG
UTR dot + 25 ….(((.(..(((((.(((((((……….))))))))))))..)..)))……(((((..(..((.(((…..((((……..))))….))).))….)..)))))…
RS 1 seq ACUUACUCAUCGGGGGGCCAGUCAUUCAUUUUGUGGAUGAUCAGCUGAGAUCAAGCAUCUGCUUGGGACCCGUAAACCUGAACCGGAUAAUGCCGGCGUAGGAAUUGAGUUUGGAGCAACC
RS 1 dot …..(((…….(((..(((((((((…)))))))))..))))))……….(((((.((((.((….((((..((((……))))..))))…)).)))).)))))…
RS 2 seq UGCGCCGCCACGGGGUGCGCCAACCAUCACUGAGUUUUGAUGGUAAGGCACUGAGAUCCAUUGGAAACCCGUUGAACCUGAUCCGGAUAGUACCGGCGUAGGGAUGGUGUUGGUCCAACAG
RS 2 dot .(((((.(…).)))))(((.(((((((……..)))))))..)))………..(((((((((((((…((((..((((……))))..))))))))).)))..)))))…
RS 3 seq GCAGCUCACUACGGGUGCCGAGUGGAAGCAGGCUCUUUGAAGCCUGUGGACACGAAGCUGAGAUUGUACCGUUACUACUCGAUCAAGUUAAUGCUUGCGUGGGAAAGUGCCGCUGCUCCAAA
RS 3 dot .((((((.((((((((..(((((……..))))…)..))))))))….)).))))…..(((.((.((((.((((..(((((….)))))..))))..)))).)).)))……

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table