Detected as a riboswitch by 14 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA053962 Similarity: 0.983 Similarity: 0.982 Similarity: 0.982
UTR: 5HSAA053962
Gene: ISYNA1
MFE: -24.281
ENS: 0.
Length: 75.
Predicted Ligands:
SAM - 6/20
cobalamin - 6/20
fluoride - 3/20
 RS: URS0000BFDCA8_1660125
MFE: -24.258
Ligand: SAM
Species: Pelagibacterium sp. SCN 64-44 SAM riboswitch (alpha-proteobacteria)
 RS: URS0000D9DDEB_52697
MFE: -30.161
Ligand: cobalamin
Species: Actinoplanes regularis Cobalamin riboswitch
 RS: URS0000BFE44F_77635
MFE: -29.006
Ligand: fluoride
Species: Bifidobacterium subtile Fluoride riboswitch
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA053962 URS0000BFDCA8_1660125 URS0000D9DDEB_52697 URS0000BFE44F_77635
Length 75. 76. 75. 74.
Similarity - 0.983 0.982 0.982
Ensemble Norm 0. - - -
MFE -24.281 -24.258 -30.161 -29.006
Ligands - SAM cobalamin fluoride
Gene ISYNA1 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 6. 5.009 3.
Length SE - 1. 0. 1.
Lev Distance - 20. 22. 22.
UBS 6. 5. 7. 6.
BS 0. 0. 0. 0.
ILL 1. 2. 1. 2.
ILR 1. 1. 1. 2.
H 2. 2. 2. 2.
BL 1. 1. 3. 1.
BR 3. 1. 3. 2.
UN 0.040 0.039 0.133 0.041

Sequences

Field Description
UTR seq + 25 ccgcgcuguccgccgccgcugccugagucgacucugcgccgcccgccgcgATGGTGGCGCCCAACGACCTCGTGT
UTR dot + 25 ..((((……..)).)).((.(((((((…..((((((((………))))))))….)))).))).))
RS 1 seq AUCGGCUCCGGUGGUGAUUUGGCCGGUCGCUUGCAGCCACUUGAAACAAAUCGCUAAAGACCGUUGCAACCGGCCG
RS 1 dot ((((.(……).))))..(((((((….((((((..(((…………..)))…))))))))))))).
RS 2 seq GGAAACCGGUGAGACUCCGGUGCGGUCGCGCCACUGUGAACCAGCCCCACCCACGGGGCCGGUGAGUCAGGACGC
RS 2 dot ….(((((…….)))))……(((.(.((((..(((.(((((……))))).)))..).)))).)))
RS 3 seq AUGAACAGCGGGUAUGAGGUUCACCCUGGGCACACGGCCCGAACCGCCUUCGGGCUGAUGACUUCUGCAGGGAU
RS 3 dot .(((((..((….))..)))))(((((.(..(((((((((((…..))))))))).))…..).)))))..

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table