Detected as a riboswitch by 2 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA053969 Similarity: 0.947 Similarity: 0.946 Similarity: 0.945
UTR: 5HSAA053969
Gene: ITCH
MFE: -90.530
ENS: 0.765
Length: 217.
Predicted Ligands:
glucosamine - 18/20
glucosamine-6-phosphate - 1/20
cobalamin - 1/20
 RS: URS00005F06FB_904749
MFE: -50.974
Ligand: glucosamine
Species: Staphylococcus aureus subsp. aureus 21269 glmS glucosamine-6-phosphate activated ribozyme
 RS: URS0000BF84B4_569857
MFE: -50.674
Ligand: glucosamine
Species: Staphylococcus microti glmS glucosamine-6-phosphate activated ribozyme
 RS: URS00004BAEFC_450394
MFE: -51.574
Ligand: glucosamine
Species: Staphylococcus aureus subsp. aureus USA300_TCH959 glmS glucosamine-6-phosphate activated ribozyme
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA053969 URS00005F06FB_904749 URS0000BF84B4_569857 URS00004BAEFC_450394
Length 217. 217. 215. 217.
Similarity - 0.947 0.946 0.945
Ensemble Norm 0.765 - - -
MFE -90.530 -50.974 -50.674 -51.574
Ligands - glucosamine glucosamine glucosamine
Gene ITCH - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 11.004 4.004 15.004
Length SE - 0. 4. 0.
Lev Distance - 64. 64. 65.
UBS 15. 13. 14. 12.
BS 0. 0. 0. 0.
ILL 2. 3. 2. 2.
ILR 5. 4. 5. 4.
H 5. 4. 4. 4.
BL 4. 2. 5. 2.
BR 4. 4. 3. 4.
UN 0.074 0.138 0.140 0.138

Sequences

Field Description
UTR seq + 25 agcugcuaacucgcucuaguagcuguggucggggcucgggaccggcugccaucuuagucuagggacugaggagucgccgccgccccgagucccgguaccaugcauuucacgguggccuuguggagacaacgccuuaacccaaggaagugacucaaacugugagaacuucagguuuuccaaccuauuggugguATGAAACTTGAAGAAGTAGTTGTGA
UTR dot + 25 ((((((((……..))))))))((((((((((((((((..((((.(((.((((((((….)))))))).)..)).)))).)))))))))))..))))).((((((..((((((.((((….)))).)))…)))….)))))).((((…..))))..(((((((((((((.(((….)))))…)))))))))))…………
RS 1 seq AGUACAGUUAAAGCGCCUGUGCAAAUAAAUAUUUGUAUUUGAAGAUUAAAGGUUAAUAUAUGAGUGGCCUUUUUAGAGUGCAAUAUAUGUAUUUGUAGACGAGGAGGAUAGUGAUCGAAUAGAUCGGCGGAUGCUAUCCCGGAUGUGGCUCAUUCGUUAGCUUAUUAAGUAAAACAUUAGGGUGACUUAAUGGACAAAGUUAAUAAGAUCGCCAGAA
RS 1 dot ……………((((((((((((.((((((((((((..(((….((((((………)))))))))..)))))))).)))).)))))))..)).))).(((((((((((…..))))…….)))))))((((((…..))))))….((((((((.(….(((((((….)))))))…..).))))))))……….
RS 2 seq UUAACAGUUAAAGCGCCAGUACAAGUGACAGCGGUUGAUUGUGGACAUAUACACUAAAGCAGAGUGCAUAUUGAGAUGGACUUGCGCACUUGUAGACGAGGAGGAUAGUGAUCGAAUCAGAUCGGCGGAUGCUAUCCCGGAUGUGGCUCAUUCGUUAGCUUAUUAAUUAAAACAAAAGGGCAACUUUUUGGACAAAGUUAAUAAGAUCGCCAACA
RS 2 dot ……………((.(((((((((.(.((((((.(((……((((.((((…….)))).))))…))).)))).))))))))))..))..)).(((((((((((……))))…….)))))))((((((…..))))))….((((((((((….(((((((….)))))))…..))))))))))……….
RS 3 seq AGUACAGUUAAAGCGCCUGUGCAAAUAAAUAUUUGUAUUUGAAGAUUAAAGGUUAAUAUAUGAGUGGCCUUUAUAGAGUGCAAUAUAUGUAUUUGUAGACGAGGAGGAUAGUGAUCGAAUAGAUCGGCGGAUGCUAUCCCGGAUGUGGCUCAUUCGUUAGCUUAUUAAGUAAAACAUUAGGGUGACUUAAUGGACAAAGUUAAUAAGAUCGCCAGAA
RS 3 dot ……………((((((((((((.((((((((((((……(((((((((………)))))))))..)))))))).)))).)))))))..)).))).(((((((((((…..))))…….)))))))((((((…..))))))….((((((((.(….(((((((….)))))))…..).))))))))……….

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table