Detected as a riboswitch by 14 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA054181 Similarity: 0.990 Similarity: 0.990 Similarity: 0.988
UTR: 5HSAA054181
Gene: ITGB6
MFE: -2.695
ENS: 0.883
Length: 41.
Predicted Ligands:
preQ_1 - 12/20
SAM - 6/20
guanidine - 1/20
 RS: URS0000BE9632_1514904
MFE: -10.995
Ligand: SAM
Species: Ahrensia marina SAM riboswitch (alpha-proteobacteria)
 RS: URS0000BE9AC2_1514904
MFE: -10.827
Ligand: SAM
Species: Ahrensia marina SAM riboswitch (alpha-proteobacteria)
 RS: URS0000CBFF2B_2021
MFE: -13.547
Ligand: guanidine
Species: RNA (41-MER) from Thermobifida fusca (PDB 5NY8, chain B)
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA054181 URS0000BE9632_1514904 URS0000BE9AC2_1514904 URS0000CBFF2B_2021
Length 41. 41. 41. 41.
Similarity - 0.990 0.990 0.988
Ensemble Norm 0.883 - - -
MFE -2.695 -10.995 -10.827 -13.547
Ligands - SAM SAM guanidine
Gene ITGB6 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 4.021 4.021 6.134
Length SE - 0. 0. 0.
Lev Distance - 13. 13. 14.
UBS 2. 2. 2. 3.
BS 0. 0. 0. 0.
ILL 0. 1. 1. 1.
ILR 0. 1. 1. 1.
H 1. 1. 1. 2.
BL 1. 0. 0. 0.
BR 1. 0. 0. 0.
UN 0.390 0.244 0.244 0.024

Sequences

Field Description
UTR seq + 25 gcaagaacugaaacgaATGGGGATTGAACTGCTTTGCCTGT
UTR dot + 25 …………….(((((.(………..).)))))
RS 1 seq AAUAGAUUUCGUGGUGAUUUGGCCGGUCGGCUUGCAGCCAC
RS 1 dot ……….(((((…..((((….))))….)))))
RS 2 seq GUUAUUCAUUGUGGUGAUUUGGCCGGUCGGCUUGCAGCCAC
RS 2 dot ……….(((((…..((((….))))….)))))
RS 3 seq CCGGACGAGGUGCGCCGUACCCGGUCAGGACAAGACGGCGC
RS 3 dot ((……)).(((((((..((…..))…..)))))))

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table