Detected as a riboswitch by 15 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA054184 Similarity: 0.931 Similarity: 0.928 Similarity: 0.927
UTR: 5HSAA054184
Gene: ITGB6_0
MFE: -43.748
ENS: 0.868
Length: 220.
Predicted Ligands:
cobalamin - 16/20
glucosamine - 2/20
FMN - 1/20
 RS: URS0002322378_1849360
MFE: -55.524
Ligand: cobalamin
Species: Balneola sp. EhC07 Cobalamin riboswitch
 RS: URS00023183FF_1262955
MFE: -57.067
Ligand: cobalamin
Species: Ruminococcus sp. CAG:353 Cobalamin riboswitch
 RS: URS0002325BBA_1408254
MFE: -60.886
Ligand: cobalamin
Species: Brevibacillus panacihumi W25 Cobalamin riboswitch
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA054184 URS0002322378_1849360 URS00023183FF_1262955 URS0002325BBA_1408254
Length 220. 219. 219. 218.
Similarity - 0.931 0.928 0.927
Ensemble Norm 0.868 - - -
MFE -43.748 -55.524 -57.067 -60.886
Ligands - cobalamin cobalamin cobalamin
Gene ITGB6 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 10.027 28. 18.019
Length SE - 1. 1. 4.
Lev Distance - 87. 82. 82.
UBS 12. 11. 14. 12.
BS 0. 0. 1. 0.
ILL 3. 3. 5. 1.
ILR 4. 2. 3. 3.
H 4. 6. 4. 6.
BL 1. 1. 4. 4.
BR 3. 2. 6. 3.
UN 0. 0.265 0.114 0.239

Sequences

Field Description
UTR seq + 25 gguagccucuguuuucauuucagucuuaaugaaaacuuucuaacuuauaucucaaguuucuuuucaaagcaguguaaguaguauuuaaaauguuauacuucaagaaagaaagacuuuaacgauauucagcguuggucuuguaacgcugaagguaauucauuuuuuaaucggucugcacagcaagaacugaaacgaATGGGGATTGAACTGCTTTGCCTGT
UTR dot + 25 ……….(((((((((……..)))))))))……….(((((..(((((((((((……(((((((……………)))))))….))))))..)))))….)))))(((((((((……)))))))))(((((((((((((.((..(((((((((…))).)).)))))).)))))))…………))))))..
RS 1 seq UUAAAAGUCAACGGUGUUGGUUUUGGAAACAAGUUCGUUUCUGAAUUAAAAGGGAAUUCCGUGAUUCUGAAUCUUCAGCUAAAUCGGAAGCUGUUCCCGCAACUGUAAUCCUUUUCGGCAAUAGCCGGAACCGCAGCCUCACCUUUGCCACUGAUCAAUAGGAUCGGGAAGGCGCUGCACAAGGAAAGCCAGGAGACCUGCCAAUACGUAAAUUUUUCA
RS 1 dot ……..((((…))))..(((((((((……)))))))))……((((((((((…..((((….))))……))))….))))))…………..(((((((….)))))))..(((((….(((((….((((((…..))))))))))).)))))………(.((((…)))).)……………..
RS 2 seq AAUAACUAUCGGGAUACAGGUGCAAAAGCAGUGCUUUUAACAAAAGGCUGCCAAGCCUAACAAGGAAUCAGGUGCGAAUCCUGAGCAAGGCCGUUGCCGUAUUUUGUCUUAACGCAUACAUGACGUGAGUCAGUCACUGGAGAGUUUCUUCGGGAAGGCGUAUGCGAGCCGUUCUGGCGGGCAAUAAGUCGGAAUACUUGCCUGUAUCCUCCCCGUGCA
RS 2 dot ……….(((((((((((((….)))((((…..(((((((((.((…((((….((((.((……)).))))…..)))).)).)))…))))))……))))……((((.(((..((.(((((((…))))))))).))).))))((((..((((((((………)))))))).))))))))))))))………
RS 3 seq GAAUACGAUUGACAAACAGGUCCUUGUUUAUGCGAGCGAGACAUUCGGAUAAGCAAGGUUAAAAGGGAAGUUUGGUGAAAAGCCAACGCGGUCCCGCCACUGUAUGAGAGGAGCUUUUUCUUCACGGCGCGAUGCCAUCCACUGCCCGGUCAGGGUGGGAAGGAGAAGAAAGGCGAUGAUUCUUGAGCCAGGAGACCUGCCUGUUUUUGUGUUGCACU
RS 3 dot …………………((((((((((.((((…….)))).))))))))))……((((.(((((((…..))))).))..))))…………((((((….))))))..(((…..))).(((.((((((…..))))))…)))(((((.(((((….((((((…))))))…))))).)))))……….

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table