Detected as a riboswitch by 20 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA054303 Similarity: 0.987 Similarity: 0.986 Similarity: 0.985
UTR: 5HSAA054303
Gene: ITPKC
MFE: -24.914
ENS: 0.990
Length: 58.
Predicted Ligands:
unknown - 14/20
cobalamin - 6/20

 RS: URS0000D69519_12908
MFE: -15.257
Ligand: unknown
Species: unclassified sequences nhaA-I RNA
 RS: URS0000D67764_322710
MFE: -25.021
Ligand: unknown
Species: Azotobacter vinelandii DJ nhaA-I
 RS: URS0000E60365_1792307
MFE: -22.417
Ligand: unknown
Species: Bosea sp. PAMC 26642 nhaA-I RNA
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA054303 URS0000D69519_12908 URS0000D67764_322710 URS0000E60365_1792307
Length 58. 58. 58. 57.
Similarity - 0.987 0.986 0.985
Ensemble Norm 0.990 - - -
MFE -24.914 -15.257 -25.021 -22.417
Ligands - unknown unknown unknown
Gene ITPKC - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 2.007 6.001 3.
Length SE - 0. 0. 1.
Lev Distance - 17. 17. 18.
UBS 5. 6. 5. 6.
BS 0. 0. 0. 0.
ILL 0. 0. 0. 1.
ILR 0. 1. 1. 0.
H 2. 2. 2. 2.
BL 3. 3. 1. 2.
BR 3. 3. 2. 3.
UN 0.069 0.155 0.034 0.053

Sequences

Field Description
UTR seq + 25 gggucggccgaagcccgaaccgaaggagcgggcATGAGGCGCTGCCCGTGCCGTGGGA
UTR dot + 25 ((((……..))))…((.(.((.(((((((……..))))))).)).).)).
RS 1 seq GGGUGUACACGGUGCAUAUUGCUGCGUGACAGGUUUUAGCGUAGGUCGGGCCGCCACG
RS 1 dot ..((((((…))))))…((.((.(((((.((….)).)..)))).)).))….
RS 2 seq GGGUGUCGGGUCCGCGGGUGCGGCCGGACAGGUUUCUUGUGUCGGUCGGGCCGCCGCA
RS 2 dot .((……..))((((((.((((((((((((…))))).))))))).)))..))).
RS 3 seq GGGUGUUCCGCUCCAAUCGUUGAGCGGGCAGGACGAGCGUAGGUCGGGCCGCCAGCG
RS 3 dot (((((…))).))…(((((.((((.(..(((……..))).).)))))))))

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table