Detected as a riboswitch by 5 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA054491 Similarity: 0.987 Similarity: 0.985 Similarity: 0.985
UTR: 5HSAA054491
Gene: JAM3
MFE: -9.095
ENS: 0.808
Length: 38.
Predicted Ligands:
SAM - 10/20
preQ_1 - 6/20
fluoride - 1/20
 RS: URS0000D92E6B_1802287
MFE: -9.182
Ligand: fluoride
Species: Syntrophobacterales bacterium GWC2_56_13 Fluoride riboswitch
 RS: URS0000D87AB1_1686310
MFE: -13.459
Ligand: SAM
Species: Bartonella apis SAM riboswitch (alpha-proteobacteria)
 RS: URS0000BE9632_1514904
MFE: -10.995
Ligand: SAM
Species: Ahrensia marina SAM riboswitch (alpha-proteobacteria)
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA054491 URS0000D92E6B_1802287 URS0000D87AB1_1686310 URS0000BE9632_1514904
Length 38. 38. 36. 41.
Similarity - 0.987 0.985 0.985
Ensemble Norm 0.808 - - -
MFE -9.095 -9.182 -13.459 -10.995
Ligands - fluoride SAM SAM
Gene JAM3 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 1.034 2.033 2.
Length SE - 0. 4. 9.
Lev Distance - 17. 16. 11.
UBS 3. 3. 2. 2.
BS 0. 0. 0. 0.
ILL 1. 0. 1. 1.
ILR 1. 1. 1. 1.
H 1. 1. 1. 1.
BL 0. 0. 0. 0.
BR 1. 1. 0. 0.
UN 0.237 0.053 0.056 0.244

Sequences

Field Description
UTR seq + 25 agcaacccucgacATGGCGCTGAGGCGGCCACCGCGAC
UTR dot + 25 ……..(((…((((((….))).)))…))).
RS 1 seq GGGGUUCACCGCAACCGCCGCUCGGCUGAUAACUCCUA
RS 1 dot (((((((((((………..))).)))..)))))..
RS 2 seq CGUGGUGAUUUGGGCCGGCCGGCUUGCAGCCACGCU
RS 2 dot ((((((…..(((((….)))))…))))))..
RS 3 seq AAUAGAUUUCGUGGUGAUUUGGCCGGUCGGCUUGCAGCCAC
RS 3 dot ……….(((((…..((((….))))….)))))

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table