Detected as a riboswitch by 18 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA054498 Similarity: 0.987 Similarity: 0.985 Similarity: 0.985
UTR: 5HSAA054498
Gene: JAZF1
MFE: -19.984
ENS: 0.942
Length: 76.
Predicted Ligands:
SAM - 8/20
homocysteine - 8/20
cobalamin - 2/20
 RS: URS0000D900DF_342002
MFE: -26.342
Ligand: cobalamin
Species: Mycobacterium arupense Cobalamin riboswitch
 RS: URS0000BEFB44_1736537
MFE: -15.801
Ligand: SAM
Species: Devosia sp. Root436 SAM riboswitch (alpha-proteobacteria)
 RS: URS0000DA793B_1803431
MFE: -19.542
Ligand: SAM
Species: Acidobacteria bacterium 13_1_20CM_3_53_8 SAM riboswitch (alpha-proteobacteria)
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA054498 URS0000D900DF_342002 URS0000BEFB44_1736537 URS0000DA793B_1803431
Length 76. 76. 76. 76.
Similarity - 0.987 0.985 0.985
Ensemble Norm 0.942 - - -
MFE -19.984 -26.342 -15.801 -19.542
Ligands - cobalamin SAM SAM
Gene JAZF1 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 9.002 2.001 3.003
Length SE - 0. 0. 0.
Lev Distance - 14. 19. 19.
UBS 6. 8. 6. 6.
BS 0. 0. 0. 0.
ILL 3. 2. 2. 2.
ILR 2. 2. 1. 3.
H 1. 1. 1. 1.
BL 1. 3. 1. 1.
BR 3. 3. 3. 2.
UN 0.184 0.145 0.158 0.132

Sequences

Field Description
UTR seq + 25 uaaucagcuguaagugccgucacuggauagaagguccguccuugggucuguATGACAGGCATCGCCGCCGCCTCCT
UTR dot + 25 ……((.((..(((((((((..((((..((((…..))))..))))…)))).))))).)).))……..
RS 1 seq CAGGAAUCCGGUGCGAGUCCGGAGCGGUCCCGCCACUGUGAUCGGGCCAGUGCGCUCGCCCGAGAGUCAGAUACUG
RS 1 dot …((.(((((.(((((..((.(..((((((((….)))…)))))..).)))))))))).)).))……..
RS 2 seq UCACAGUCCAGUGGUGAUUUGGCCGGUCGCUUGCAGCCACUUAAAAGAAAUCGCUAAAGACCGUCGUGGGAACCGG
RS 2 dot ……(((((((((..(((((.((((..(((…………)))..))))))))).)))).).))))……
RS 3 seq AUUGAAAAACGUGGUGAGUUAAGGCGACUUGCGGCCACGCAAAACAAGCAGCUAAACAGCUCGGUAGCGUUUCCCC
RS 3 dot ……(((((((.((((((..(((..((((((….))))…..))..)))….)))))).)).)))))….

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table