Detected as a riboswitch by 16 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA054499 Similarity: 0.989 Similarity: 0.986 Similarity: 0.986
UTR: 5HSAA054499
Gene: JAZF1_0
MFE: -14.895
ENS: 0.927
Length: 65.
Predicted Ligands:
fluoride - 18/20
Ni/Co - 1/20
cobalamin - 1/20
 RS: URS0000D68140_12908
MFE: -9.466
Ligand: Ni/Co
Species: unclassified sequences NiCo riboswitch
 RS: URS0000DAE5DE_518642
MFE: -23.170
Ligand: fluoride
Species: Streptomyces nanshensis Fluoride riboswitch
 RS: URS0000DA2125_146922
MFE: -23.951
Ligand: fluoride
Species: Streptomyces griseofuscus Fluoride riboswitch
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA054499 URS0000D68140_12908 URS0000DAE5DE_518642 URS0000DA2125_146922
Length 65. 65. 64. 65.
Similarity - 0.989 0.986 0.986
Ensemble Norm 0.927 - - -
MFE -14.895 -9.466 -23.170 -23.951
Ligands - Ni/Co fluoride fluoride
Gene JAZF1 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 5. 8. 4.004
Length SE - 0. 1. 0.
Lev Distance - 13. 15. 18.
UBS 5. 6. 6. 5.
BS 0. 0. 0. 0.
ILL 1. 3. 2. 2.
ILR 1. 1. 0. 0.
H 1. 1. 1. 1.
BL 2. 2. 1. 1.
BR 2. 2. 4. 3.
UN 0.154 0.154 0.172 0.215

Sequences

Field Description
UTR seq + 25 aauauuuauaagggggauugugcaagaguuugugugacagATGACAGGCATCGCCGCCGCCTCCT
UTR dot + 25 ……….((((((.(.(((…((((((((……….)))))).))..))).)))))))
RS 1 seq AUAUAAUAAUUCGAUCAAGCACAUAAGGUAGCUGGGCUUAGGCAACGGGAAACCGUGGGACGAAA
RS 1 dot ………((((.((…(((….(((..((.(……….).))..)))))).)))))).
RS 2 seq CAGUGUGCAGGUGAUGGGGCUCACCGCAACCGCGGCCUGUGCCGCUGACGGUCCCUGGUCCACG
RS 2 dot ……….(((((.(((…((((((…(((((….))))))).)))).))).)).))).
RS 3 seq CGACGCGCCGGUGAUGGGGCUCACCGCAACCGCGGCACCAUGCCGCUGACGGUCCCUGGUCGAAC
RS 3 dot ………..((((.(((…((((((…((((((…)))))))).)))).))).))))…

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table