Detected as a riboswitch by 20 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA054527 Similarity: 0.985 Similarity: 0.985 Similarity: 0.984
UTR: 5HSAA054527
Gene: JMJD8
MFE: -38.477
ENS: 0.972
Length: 82.
Predicted Ligands:
homocysteine - 9/20
zmp-ztp - 6/20
cyclic-di-GMP - 3/20
 RS: URS0000C1FD53_12908
MFE: -20.387
Ligand: zmp-ztp
Species: unclassified sequences ZMP/ZTP riboswitch
 RS: URS0000D86786_1895733
MFE: -31.546
Ligand: homocysteine
Species: Burkholderiales bacterium 70-64 S-adenosyl-L-homocysteine riboswitch
 RS: URS0000DB0CFB_1121279
MFE: -28.992
Ligand: homocysteine
Species: Chitinimonas taiwanensis DSM 18899 S-adenosyl-L-homocysteine riboswitch
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA054527 URS0000C1FD53_12908 URS0000D86786_1895733 URS0000DB0CFB_1121279
Length 82. 82. 82. 81.
Similarity - 0.985 0.985 0.984
Ensemble Norm 0.972 - - -
MFE -38.477 -20.387 -31.546 -28.992
Ligands - zmp-ztp homocysteine homocysteine
Gene JMJD8 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 10.005 7.001 7.001
Length SE - 0. 0. 1.
Lev Distance - 16. 18. 18.
UBS 7. 8. 7. 8.
BS 0. 0. 0. 0.
ILL 1. 1. 2. 2.
ILR 2. 1. 1. 2.
H 1. 1. 1. 1.
BL 4. 6. 3. 3.
BR 2. 4. 4. 4.
UN 0.073 0.146 0.098 0.049

Sequences

Field Description
UTR seq + 25 acuuccgggguccgucccgguucccggccguugccacgacgacgaagcugccggccaATGGCTGGCGGATGGGCCCAAGGTT
UTR dot + 25 ….((.(((((((((.((….((((((((((((.((.(……).))..))).))))))))))))))))))))..))..
RS 1 seq AAAAAGAUCCGUGACUGACGGUUUUUGUGGGGCACCACCAGGGAGCGGAUUCUUAAAAAGGCCGACCGUCUGGGCAGCAUCU
RS 1 dot …..(.((((.(((.(.((((((((.(((((..((.(……).))..))))).)))))))).).))))))))…….
RS 2 seq CAUCCCGAGGAGCGCUGCAACGGGUUCCGGCAUGUCCGGAACCGCCAGGCUCGGGGCCGUGUACCAACCGCGCUCGUUGAUC
RS 2 dot …..(((.((((((…….((((…((((((((.((.((….)).)).)))).))))…)))))))))).)))…
RS 3 seq CUAACCGAGGAGCGCUGCGACAGGGUUCCCUGCCAGGCUCGGUUUUCGCGCACUGCGCGGCAAGAACGGCGCUCACCUGUC
RS 3 dot …((.(..(((((((……..((((.(((((((((.((…..)).)).))).))))…)))))))))))..).)).

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table