Detected as a riboswitch by 3 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA054735 Similarity: 0.986 Similarity: 0.985 Similarity: 0.985
UTR: 5HSAA054735
Gene: KBTBD8
MFE: -19.826
ENS: 0.785
Length: 78.
Predicted Ligands:
SAM - 16/20
zmp-ztp - 3/20
Ni/Co - 1/20
 RS: URS0000BE3FE8_1287182
MFE: -25.365
Ligand: SAM
Species: Mesorhizobium sp. L48C026A00 SAM riboswitch (alpha-proteobacteria)
 RS: URS0000BE870D_381
MFE: -25.778
Ligand: SAM
Species: Mesorhizobium loti SAM riboswitch (alpha-proteobacteria)
 RS: URS0000BFE934_69279
MFE: -25.177
Ligand: SAM
Species: Aquamicrobium defluvii SAM riboswitch (alpha-proteobacteria)
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA054735 URS0000BE3FE8_1287182 URS0000BE870D_381 URS0000BFE934_69279
Length 78. 78. 78. 78.
Similarity - 0.986 0.985 0.985
Ensemble Norm 0.785 - - -
MFE -19.826 -25.365 -25.778 -25.177
Ligands - SAM SAM SAM
Gene KBTBD8 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 10.003 2.013 5.016
Length SE - 0. 0. 0.
Lev Distance - 16. 20. 19.
UBS 6. 7. 6. 6.
BS 0. 0. 0. 0.
ILL 1. 1. 1. 1.
ILR 1. 1. 1. 1.
H 2. 2. 2. 2.
BL 3. 3. 2. 2.
BR 1. 4. 2. 3.
UN 0.026 0.077 0.141 0.154

Sequences

Field Description
UTR seq + 25 aagcgaaaugacauuuccuuuuuaaauagcuggagucggggccccaucgagaaATGGCCGCGTCGGCAGATTTAAGTA
UTR dot + 25 (((.(((((…))))))))(((((((.(((((…((.((((…………)))).)))))))..)))))))..
RS 1 seq UCGUUAUCCCGUGGUGAUUUGGCCGGUCGGCUUGCAGCCACGUUAAACAAGUCGCUAAAGGACCGUCGGGCCGAAAGG
RS 1 dot ..((((((….))))))((((((.(.((((((..(((.((………)).)))..))).))).).))))))….
RS 2 seq UCGUUAUCCCGUGGUGAUUUGGCCGGUCGGCUUGCAGCCACGUUAAACAAGUCGCUAAAGGACCGCUGGCCGCAAGGC
RS 2 dot ..((((((….))))))..((((((.((((((..(((.((………)).)))..))).)))))))))…….
RS 3 seq GGCUUAUCCCGUGGUGAUUUGGCCGGUCGGCUUGCAGCCACGUUAAACAAGUCGCUAAAGGACCGUCUGGCCUCAAGG
RS 3 dot …(((((….)))))…((((((.((((((..(((.((………)).)))..))).))).))))))……

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table