Detected as a riboswitch by 20 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA054925 Similarity: 0.958 Similarity: 0.957 Similarity: 0.957
UTR: 5HSAA054925
Gene: KCNK3
MFE: -37.388
ENS: 0.995
Length: 146.
Predicted Ligands:
FMN - 12/20
cobalamin - 6/20
SAM - 1/20
 RS: URS00023246F5_1660094
MFE: -42.801
Ligand: cobalamin
Species: Clostridium sp. SCN 57-10 Cobalamin riboswitch
 RS: URS0000D85DC8_214095
MFE: -29.254
Ligand: cobalamin
Species: Enterococcus canis AdoCbl riboswitch
 RS: URS0000C051F1_1838280
MFE: -55.443
Ligand: SAM
Species: Desulfotomaculum copahuensis SAM riboswitch (S box leader)
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA054925 URS00023246F5_1660094 URS0000D85DC8_214095 URS0000C051F1_1838280
Length 146. 146. 146. 146.
Similarity - 0.958 0.957 0.957
Ensemble Norm 0.995 - - -
MFE -37.388 -42.801 -29.254 -55.443
Ligands - cobalamin cobalamin SAM
Gene KCNK3 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 12.007 4.002 5.001
Length SE - 0. 0. 0.
Lev Distance - 52. 56. 56.
UBS 9. 10. 8. 10.
BS 0. 0. 0. 0.
ILL 2. 2. 3. 1.
ILR 2. 3. 2. 3.
H 4. 3. 3. 4.
BL 1. 4. 1. 2.
BR 3. 3. 2. 2.
UN 0.164 0.247 0.123 0.192

Sequences

Field Description
UTR seq + 25 uguaauaugaagauaaucauaauagugaccuuguaagaaguuuuugaggauuaaguuaaaaauacaucugaagggcuacgggcacgcggcacccagcacggauggcggcaagguguucugcATGAAGCGGCAGAACGTGCGCACGC
UTR dot + 25 …..(((((……)))))………………((((((((……..)))))))).((((((..(((((.((….)).))).))…..))))))(((((….((((((((……..))))))))…)).)))
RS 1 seq UUGAAUUGAAUAUUUUAUGGUUGCAGAGCAGCGCUUAAAAGCUGCUUUCCGGGGAAGUUGGGUGAAAAUCCCACACGGUCCCGCCACUGUGAACAGGCAUUGCGCCUGGAAGUCAGGAUACCGGAAACCAUAAUGCGUACUGCCCA
RS 1 dot ………………….(.((((((((……..)))))))))(((((..((((((…….)))).))..)))))…………((((.(((((.(((…((.((…)).))..)))….))))).))))..
RS 2 seq UCAAUCAGACUCUAUGAAAAAUACGGAUGGAAGUUAGUGAAAAUCUAACACGGUCCCGCCACUGUGAUGAGCACAAUGCUCUAAGUCAGGUCUUUCCGCUUUUCAUUAUCGGGCAUGCUGUUUCGAGGCUAAACAGGAUGUUUCUU
RS 2 dot ……….(((((………..)))))…(((((((((…….(((….(((….(((((((((…)))))…)))))))….))).)))))))))..((((((.((((((…….)))))).))))))…
RS 3 seq CUCUUAUCCAGAGUGGUGGAGGGACUGGCCCGAUGAAACCCGGCAACCGCUUUCCUUCAAGGCUUUGCGGCCCCGGCGCAAAGCCCGGUACAAAGGAAGGUAUGGUGCCAAUUCCUGCAGAAGAUUUAUCUUCUGACAGAUAAGAG
RS 3 dot ……((((……))))(((…..)))……….(((.(((((((((((((..(((((((((.(…).)))))))))..)….)))))))))..))))))…..((((((((((….))))))).)))…….

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table