Detected as a riboswitch by 2 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA055008 Similarity: 0.977 Similarity: 0.976 Similarity: 0.976
UTR: 5HSAA055008
Gene: KCNU1
MFE: -22.635
ENS: 0.843
Length: 112.
Predicted Ligands:
methionine - 12/20
SAM - 4/20
cobalamin - 1/20
 RS: URS0000AB8674_446469
MFE: -44.224
Ligand: methionine
Species: Sanguibacter keddieii DSM 10542 S-adenosyl methionine (SAM) riboswitch,
 RS: URS0000AB355D_247156
MFE: -49.580
Ligand: methionine
Species: Nocardia farcinica IFM 10152 S-adenosyl methionine (SAM) riboswitch,
 RS: URS0000D89830_134962
MFE: -50.830
Ligand: methionine
Species: Nocardia soli S-adenosyl methionine (SAM) riboswitch,
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA055008 URS0000AB8674_446469 URS0000AB355D_247156 URS0000D89830_134962
Length 112. 112. 111. 111.
Similarity - 0.977 0.976 0.976
Ensemble Norm 0.843 - - -
MFE -22.635 -44.224 -49.580 -50.830
Ligands - methionine methionine methionine
Gene KCNU1 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 11.001 7.001 7.001
Length SE - 0. 1. 1.
Lev Distance - 27. 28. 28.
UBS 8. 7. 9. 9.
BS 0. 0. 0. 0.
ILL 2. 4. 4. 4.
ILR 1. 2. 2. 2.
H 2. 2. 2. 2.
BL 2. 0. 2. 2.
BR 2. 1. 3. 3.
UN 0.152 0.116 0.117 0.117

Sequences

Field Description
UTR seq + 25 acagugaacucugauuccuggaauuguuaccaggcgaccacggcgucaucaaaugaccuggcaauuccgucuacugaugucucgaacATGTTTCAGACTAAGCTACGAAATG
UTR dot + 25 .(((((.((……….(((((((…(((((((((……)))…….).)))))))))))))).)))))..((((.(((…..)))))))…………..
RS 1 seq GGUCACGAGAACCGACGCGAAGCCCCGGCUGGUCGGACAGCAACCCCCAUGUCACGGCGGGGUGCUCCGGGAGAUGACCUGGCCGGCCCCUCCGGGUCGGCAAGCCACGACG
RS 1 dot (((((……(((..((…(((((…..((((((((……….)))).)))))))))))..)))….)))))..((((((((….))))))))………..
RS 2 seq GGUCAUGAGCGCCAGCGUCAAGCCCCGGCUCGCUGGCCGGCAACCCUCCAGCUGCGGUGGGGUGCUCCGGGUGAUGACCGGGCUCCCGAAGGUCGGGGGCAAGCGCGCUCG
RS 2 dot ((((((…((((..((…((((((.(((.(((((..((…))..)))))…))).))).))).))))))))))))..((((((((…))))))))………..
RS 3 seq GGUCAUGAGUACCAGCGUCAAGCCCCGGCUCGCUGGUCGGCAACCCUCCAGCUGCGGUGGGGUGCUCCGGGUGAUGACCGGGCCCUCGAAGGUCGAGGGCAAGCGCGCAUU
RS 3 dot ((((((…((((..((…((((((.(((.(((((..((…))..)))))…))).))).))).))))))))))))..((((((((…))))))))………..

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table