Detected as a riboswitch by 1 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA055010 Similarity: 0.984 Similarity: 0.984 Similarity: 0.983
UTR: 5HSAA055010
Gene: KCNU1_0
MFE: -8.415
ENS: 0.776
Length: 73.
Predicted Ligands:
fluoride - 9/20
SAM - 6/20
homocysteine - 2/20
 RS: URS0000BF2D2F_338565
MFE: -17.281
Ligand: fluoride
Species: Erwinia tasmaniensis Fluoride riboswitch
 RS: URS0000C83C25_1105031
MFE: -13.905
Ligand: fluoride
Species: Clostridium sp. MSTE9 Fluoride riboswitch
 RS: URS0000BE1DBC_1734400
MFE: -10.215
Ligand: SAM
Species: bacterium BRH_c32 SAM riboswitch (alpha-proteobacteria)
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA055010 URS0000BF2D2F_338565 URS0000C83C25_1105031 URS0000BE1DBC_1734400
Length 73. 73. 73. 74.
Similarity - 0.984 0.984 0.983
Ensemble Norm 0.776 - - -
MFE -8.415 -17.281 -13.905 -10.215
Ligands - fluoride fluoride SAM
Gene KCNU1 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 8.001 3.002 4.006
Length SE - 0. 0. 1.
Lev Distance - 19. 21. 20.
UBS 4. 5. 4. 3.
BS 0. 0. 0. 0.
ILL 1. 0. 0. 0.
ILR 0. 1. 1. 1.
H 2. 2. 3. 2.
BL 1. 3. 1. 0.
BR 0. 1. 0. 0.
UN 0.315 0.288 0.274 0.392

Sequences

Field Description
UTR seq + 25 ggauuagaaaggugcagcagcuauugaguagugccaucgguaaagagaATGTTTCAGACTAAGCTACGAAATG
UTR dot + 25 ……….((((..(((.((((…)))))))))))…………(((((…………))))).
RS 1 seq GUAUCACAAGGUGAUGGUGCUCCACCUUUCCCAACCGCCCUGAUUUUUUCGGGCUGAUGACGCCUGAUAAAAC
RS 1 dot ………((.((.((((…))))..))))………..((((.((((((…….)))))).)))).
RS 2 seq AAUUUUUCUGGGAAUGAAGUUCUCCCGCGGCAUUGCCGAAACUGCUUAUUUAGCUGAUGACUUCUGCGCUGGC
RS 2 dot ……..(((((………)))))((((…))))………..(((((.((…..))…))))).
RS 3 seq UUGUGGUGAAGUCGUGAUUUAUACGAAUUGCAGCGACUUAAAAUAAAUAGCUAAAUAGUAGGAAAAGUUUUCUU
RS 3 dot ……..((((((((((((….)))))…)))))))………………..(((((….))))).

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table