Detected as a riboswitch by 10 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA055122 Similarity: 0.969 Similarity: 0.966 Similarity: 0.964
UTR: 5HSAA055122
Gene: KCTD9
MFE: -30.392
ENS: 0.872
Length: 140.
Predicted Ligands:
cobalamin - 8/20
FMN - 4/20
Mn2+ - 4/20
 RS: URS0000C80BEC_1470558
MFE: -64.451
Ligand: glycine
Species: Cupriavidus sp. SK-3 Glycine riboswitch
 RS: URS0000DCD718_96344
MFE: -61.603
Ligand: glycine
Species: Cupriavidus oxalaticus Glycine
 RS: URS000232BC0D_1184607
MFE: -41.441
Ligand: cobalamin
Species: Austwickia chelonae NBRC 105200 Cobalamin riboswitch
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA055122 URS0000C80BEC_1470558 URS0000DCD718_96344 URS000232BC0D_1184607
Length 140. 140. 139. 140.
Similarity - 0.969 0.966 0.964
Ensemble Norm 0.872 - - -
MFE -30.392 -64.451 -61.603 -41.441
Ligands - glycine glycine cobalamin
Gene KCTD9 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 9. 8. 8.017
Length SE - 0. 1. 0.
Lev Distance - 38. 41. 46.
UBS 9. 8. 8. 9.
BS 0. 0. 0. 0.
ILL 2. 2. 3. 2.
ILR 2. 0. 0. 0.
H 5. 5. 5. 5.
BL 1. 1. 0. 1.
BR 0. 2. 1. 2.
UN 0.093 0.093 0.079 0.221

Sequences

Field Description
UTR seq + 25 gcugggaucgaguauacucuugacuuaaauauguuuguuuauaaagacaaauggagaaaucaauuuuuuucccugaauucuuaggagcacuuuagugaauaaagaaccugacaguATGAGGCGGGTGACCCTGTTCCTGA
UTR dot + 25 ..((((.(((((……)))))))))…..((((((((….))))))))(((((((……)))))))(((…..(((((….(((((…..)))))..))))))))….(((((((….))))..)))..
RS 1 seq ACGCCGUACUCUGGAGAGCGGCACCCGCCAUUGCUGAAUCAAUGGUGAGCGUGCCCACCGAAGGGGCGCGCAAGGCCUGGGUCCUGGUUUAGCCGGGGCCGCCUUGUAAUCUCUCAGGUAUCGAGGACAGAGGGGUCAUC
RS 1 dot ..(((((.((….)).)))))…((((((((……))))))))..(((((((…….)))))))((((((…(((((((((…)))))))))))))))..(((((((..((…….)).)))))))….
RS 2 seq AUGCCGAACUCUGGAGAGCGGCACCCGCCAUGCGUGGCGAGCGUGCCCACCGAAGGGGCGCGCGAGGCAGAUGUUGAUCGGAUCCGGUCCACCGGAUCCGCCUCGUAAUCUCUCAGGUAUCGAGGACAGAGGGGUCAUC
RS 2 dot .(((((..(((….))))))))..(((((….)))))..(((((((…….)))))))((((((………..((((((((….))))))))))))))..(((((((..((…….)).)))))))….
RS 3 seq UAACAUGACAGCACUGUCGAUCAUUUCUUCCCAGCGGAGAAAAGCAGGAUAAGCCGGUGAGAAUCCGGCCCUGGCGCGCAACGGUAAACCCUGCACAUUCGGGGAAAAGGCCGAACACCUGACGGCAGGCUGCGGCAUCA
RS 3 dot …..(((((….)))))..(.(((((((…..))))))).)((((….(((((…….)))))))))……………(((((……)))))…..((((..((((((….)))).))))))….

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table