Detected as a riboswitch by 20 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA055147 Similarity: 0.962 Similarity: 0.961 Similarity: 0.961
UTR: 5HSAA055147
Gene: KDELR3
MFE: -36.613
ENS: 0.952
Length: 150.
Predicted Ligands:
molybdenum - 6/20
FMN - 6/20
glucosamine - 4/20
 RS: URS0000BEF057_1131462
MFE: -45.728
Ligand: glucosamine
Species: Dehalobacter sp. CF glmS glucosamine-6-phosphate activated ribozyme
 RS: URS0000BED6EC_1262840
MFE: -22.518
Ligand: glucosamine
Species: Clostridium sp. CAG:793 glmS glucosamine-6-phosphate activated ribozyme
 RS: URS0000D84097_1903952
MFE: -42.
Ligand: molybdenum
Species: Photobacterium proteolyticum Moco (molybdenum cofactor) riboswitch
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA055147 URS0000BEF057_1131462 URS0000BED6EC_1262840 URS0000D84097_1903952
Length 150. 149. 150. 150.
Similarity - 0.962 0.961 0.961
Ensemble Norm 0.952 - - -
MFE -36.613 -45.728 -22.518 -42.
Ligands - glucosamine glucosamine molybdenum
Gene KDELR3 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 4.016 12.020 8.010
Length SE - 1. 0. 0.
Lev Distance - 48. 48. 50.
UBS 8. 8. 10. 10.
BS 0. 0. 0. 0.
ILL 2. 3. 3. 2.
ILR 2. 3. 3. 2.
H 4. 3. 3. 4.
BL 2. 2. 4. 2.
BR 1. 2. 2. 3.
UN 0.280 0.154 0.140 0.180

Sequences

Field Description
UTR seq + 25 aacgacgacucaagugauccgaugggaagggcaucucugggaagagccagauccuguuugcucucgucuucaccaccagguaccuggaccuguucaccaacuucaucuccaucuacaacacaguaATGAACGTGTTCCGAATCCTCGGCG
UTR dot + 25 ………….((((…(((((((.(((((..(((((……)))))…)))))..))))))).))))…(((((……)))))……………………(((((.((…..)))))))((((….))))..
RS 1 seq ACAAAAAAUGUAGCGCCAGAGCCCAUUUGGGUUGACGAGGAAGAGGUUAAUCGAAGUUUUCGGCGGGUGCCUCUCGGUGGCUUGUCAUCGUUAGAUUCGUUGCAAAUCCGGAAAGCAAUUUCCGGGACAAGAGCGGAUCAAACAGGAAG
RS 1 dot ………(..(((((…(((.((((.(((((((………))))))).))))….))).)))))..).(((((……)))))…((((((((…..((((((((….))))))))…..))))))))……….
RS 2 seq UUAUUUAAGUAAGCGCCAGGACAUUUUUUUAAUGUUGACGAGGAUAGAACUUAUCGAAAUUUUCGGCGGAUGGUUCUAGGGAAUGCUACUUCCUAAAAUAUUGUCAAAAAAUAAUAGCGAUAUUAUAACAAAUCAAUAUUACUAGCUGUG
RS 2 dot ……((.((..((((.(((.(((((..(((.(((………..))))))..))))).)))))))..)).))…(((((……)))))..(((((((…….((((((….))))))…….)))))))……….
RS 3 seq CAGCAGCCAUAACUCCGAGCUUUAUUCACUAAGUUGCAGCCUUUCGGGGAUGACAAUAGGUGAAUGAAGCCAGUGACAGAGUAGUCACCAGGGUCGACAAAGAAAUGCAUCGGCCUCCCGUAUUUGGAAAGGUGUUCCGUGGCGAAUCAA
RS 3 dot …………….(.((((((((((((..((((((.(((….))).)).)))).))))))))))))).(((((……)))))..(((((((((……))..)))))))..(((…(((((…..)))))..)))……

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table