Detected as a riboswitch by 4 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA055646 Similarity: 0.949 Similarity: 0.944 Similarity: 0.941
UTR: 5HSAA055646
Gene: KIAA0586
MFE: -53.951
ENS: 0.840
Length: 204.
Predicted Ligands:
cobalamin - 20/20 - 20/20


 RS: URS00007DF233_408184
MFE: -82.912
Ligand: cobalamin
Species: Mesorhizobium sp. ORS 3359 Cobalamin
 RS: URS000231C2B3_1695218
MFE: -69.157
Ligand: cobalamin
Species: Paenibacillus sp. 32O-W Cobalamin riboswitch
 RS: URS0002327EF1_1517682
MFE: -36.857
Ligand: cobalamin
Species: Porphyromonadaceae bacterium COT-184 OH4590 Cobalamin riboswitch
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA055646 URS00007DF233_408184 URS000231C2B3_1695218 URS0002327EF1_1517682
Length 204. 204. 204. 206.
Similarity - 0.949 0.944 0.941
Ensemble Norm 0.840 - - -
MFE -53.951 -82.912 -69.157 -36.857
Ligands - cobalamin cobalamin cobalamin
Gene KIAA0586 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 8. 11.002 5.036
Length SE - 0. 0. 4.
Lev Distance - 65. 70. 70.
UBS 12. 13. 12. 12.
BS 0. 0. 2. 0.
ILL 4. 5. 4. 4.
ILR 3. 3. 5. 2.
H 4. 3. 3. 4.
BL 2. 4. 3. 4.
BR 4. 3. 3. 4.
UN 0.074 0.074 0.118 0.262

Sequences

Field Description
UTR seq + 25 aguggguguugaccugcgggcaacugacgcuguugucagauuacacccacgacggugcgggucucgggcguucuggagauacguaggggugaauuuauguuuccgacgauugcaucuggagggguucaucagacuuaacuucugcuagaaauuguuaccagccucuauuagaaaaucccATGGTGTCAGAAAGTGATTTTTCTA
UTR dot + 25 .((((((((((((..((((……….)))).))))….))))))))…..((((.(((((.((….)).))))).))))(((((……..(((…(((((((…((((((((((((……….))))))).))))))))))))…)))…………)))))……..((((((….)))))).
RS 1 seq UUAGAUCAGGCCAUCUCAGGUGCCGCUUCGUCGCGACGAGGCGGAGAAUUGGGAAGCCGGUCGAAAUCCGGCGCUGCCCCCGCAACGGUGGUGGAGUGACGUCGCAACGGGAGACCACUGGGCCAUGGGGCCUGGGAAGGUGUUGCGACCGCCCGCGAGGGCAACUCCAAAGCCCGGAAACCAGCCCGAGACAGUUUGAACUCG
RS 1 dot …((((.(((..((((((…(((((((((….)))))))))….)))))).)))))))….(((((.(((((((.(((…(((((……….(((((((…..(((.(((((((….)))))))…))))))))))))))).))).)))))……..)))))))……..((((……….))))
RS 2 seq UACAUAUUGUUUCGUUCAGGUGUUCUAUCUUCGAAGACAAAGAUAGAGCUUAAUAGGGAAUCCGGUGCGAAACCGGAGCGGUCCCGCCACUGUAUGGGCGAGCCGCAAUCCGAAAAGCCACUGGUUAAGCUGAACGCGAGCCGGGAAGGCGGAUUGCCGGCGAUGACCCCGAGCCAGGAGACCUGCCUGAACGUUGAUGGACAC
RS 2 dot …….((((((((((((((((((((((((……..))))))))))……((((.((((((…..))))))….)))).(..(((…(((((.((((((((((…..(((.((((((..((…..)).))))))…)))))))))).)))..)).)))…..)))..)….)))))))))…..))))).
RS 3 seq GCAGUCGAUUUUCGUGGUGAUAACUUUUGAGGGUUAAAAAAAGUUAGAGAGGGAAUUGGGUGAAAAUCCCAAACAGUACCCGCUGCUGUAAGUUUUAUAAAAAAUACUGUUGUGCAAGCUACAAGUACCACUGAACCAAUAGGUUUGGGAAGGUCAUAGUACAACAAAAAACGAGUCAGAAAACCUGCCAUAAAAUUAUAAUAGAU
RS 3 dot .((.(((((((((….(..((((((((……….))))))))..).))))))))).))……….((((((…..))))))………………((((((….((((…(.(((.(((((((….)))))))…)))).))))))))))……..(.(((…..))).)……………..

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table