Detected as a riboswitch by 20 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA055963 Similarity: 0.977 Similarity: 0.977 Similarity: 0.976
UTR: 5HSAA055963
Gene: KIAA1143
MFE: -28.296
ENS: 0.968
Length: 104.
Predicted Ligands:
TPP - 16/20
purine - 3/20
homocysteine - 1/20
RS: URS0000DB42F2_1434837
MFE: -34.751
Ligand: TPP
Species: Nocardiopsis sp. JB363 TPP riboswitch (THI element)
RS: URS0000BF4CDE_1712675
MFE: -17.885
Ligand: purine
Species: Turicibacter sp. H121 Purine riboswitch
RS: URS0000C06D04_1736612
MFE: -46.249
Ligand: TPP
Species: Lysobacter sp. Root96 TPP riboswitch (THI element)
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA055963 URS0000DB42F2_1434837 URS0000BF4CDE_1712675 URS0000C06D04_1736612
Length 104. 103. 102. 105.
Similarity - 0.977 0.977 0.976
Ensemble Norm 0.968 - - -
MFE -28.296 -34.751 -17.885 -46.249
Ligands - TPP purine TPP
Gene KIAA1143 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 14. 2.003 2.
Length SE - 1. 4. 1.
Lev Distance - 25. 26. 30.
UBS 7. 9. 7. 8.
BS 0. 0. 0. 0.
ILL 3. 2. 2. 4.
ILR 1. 1. 2. 1.
H 2. 2. 2. 2.
BL 2. 2. 2. 2.
BR 2. 5. 2. 2.
UN 0.096 0.087 0.147 0.105

Sequences

Field Description
UTR seq + 25 agugacgucacagcuaagcgccucuguaucgucgcgaauccgucgcggaaccugucuucugucuuuacccagagcuaccATGAGCAAGCGGAACCAGGTATCGT
UTR dot + 25 .((((((..((((……….))))..))))))………((((.(((((..(((((.(((……..(((……))))))))))).))))).))))
RS 1 seq CGCAGUGACACGGGGUGCCCUGAAUCCACUGAUUCGGGCUGAGAUGACACCCGUCGAACCUGAUCCGGAUAACGCCGGCGAAGGGAUGUCCGUACACGGCCGG
RS 1 dot ..(((((…((((….))))….)))))…..(((((.((((((((((.(((……..((((……))))))).))).)))).)).).)))))..
RS 2 seq UGGUAAAAAUGAAUAUAGACUCGUAUAUACCUGGUAAUAUGGACUGGGCGUUUCUACCUGCAAACCGUAAAAGUGCGGACUACGAGGCGUUGUUGGAUGAUU
RS 2 dot .((((…((((……..))))…))))……..(.(((..((((((((((.(((((………..)))))..)).))))))))))).)……
RS 3 seq GCACUGAAGCGGGGGUACCGCGGCGGUUCCAGGCCGGCGGUUGAGACAGUCCCUUCGAACCUGAUGCGGUUGAGACCGCCGUAGGGAAGCUUCGCCGGCCGCGCU
RS 3 dot ..((((..((((…..))))..))))….((((((((…(((.(..(((((.((……..(((((….))))))).))))).))))))))))))…..

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table