Detected as a riboswitch by 18 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA056318 Similarity: 0.956 Similarity: 0.950 Similarity: 0.949
UTR: 5HSAA056318
Gene: KIF15
MFE: -64.137
ENS: 0.924
Length: 174.
Predicted Ligands:
lysine - 7/20
cobalamin - 7/20
Mg2+ - 4/20
 RS: URS0000C6420C_1822245
MFE: -39.464
Ligand: TPP
Species: Oleiphilus sp. HI0069 TPP riboswitch (THI element)
 RS: URS0000C7644A_1195246
MFE: -65.313
Ligand: lysine
Species: Alishewanella agri BL06 Lysine riboswitch
 RS: URS0000C305F2_1513271
MFE: -41.407
Ligand: lysine
Species: Catenovulum maritimum Lysine riboswitch
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA056318 URS0000C6420C_1822245 URS0000C7644A_1195246 URS0000C305F2_1513271
Length 174. 174. 174. 174.
Similarity - 0.956 0.950 0.949
Ensemble Norm 0.924 - - -
MFE -64.137 -39.464 -65.313 -41.407
Ligands - TPP lysine lysine
Gene KIF15 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 6.005 26.016 14.021
Length SE - 0. 0. 0.
Lev Distance - 56. 55. 62.
UBS 11. 12. 10. 10.
BS 0. 0. 0. 0.
ILL 5. 5. 1. 5.
ILR 6. 4. 4. 6.
H 2. 2. 2. 2.
BL 3. 4. 5. 1.
BR 3. 3. 2. 0.
UN 0.023 0.092 0.149 0.167

Sequences

Field Description
UTR seq + 25 gcggccuccaugcgggcgucaacguccgauccaagcgccaaauucaaauuugcggccaucuugagcgggcggaauucagucgcgcgcggugcagucgggagguggaggcaccggcugcauuguuuucgggaucgaggggugagggcgcuATGGCACCCGGCTGCAAAACTGAGT
UTR dot + 25 ..(((((…..((((((….))))))…..)).)))..(((((..(((((((((..((..((((…….(((.(((.((.(((((((((((((…………)))))))))))))…)).))).)))………))))..))…..)))))))))..)))))
RS 1 seq AAAAUCUUGUCGGGGAGCAUCUGUCAUUUUAUCGCUUGAUGAUUUGCGAAUGCUGAGACCAUAUAAAUUCUUGGGAUAUAUCCAAUUAUUUGUUGUUCUACAUUUUGUAGGCAGAUAGGGACCCGUUGAACCUGAUUGGUUAGAACCAGCGUAGGGAACAAGAAUUCAUCAAGA
RS 1 dot …….((.((((…..)))).))……..(((((((((((.(..((((((.(((((……(((.((((…..(((..((((((((….(((((…))))))))))))))))))))..)))……)))))…..)))))).).)))…….)))))))).
RS 2 seq UAGACCAGAAGAGGCGCGCUAGCCAGGUAUGUGAUGUCAGAGCUCUAUCGCUCGCAGCAGCACAGAGGGGGUUUAGCGCCGAGGACAAACAACAGGUAGAGGUUGUUUGUUCGGUUGCCAGGGCUGAAUCCCUGGGACUGUCACCUGAUGUUUUGGUGGAGAGCUUCUGGCCUU
RS 2 dot …………(((……)))………..(((((((((((.(((((.(((.(((.((((.((((((((((((((((..(((((((((……..))))))))))))))…….)))))))))))….))))…))).)))…))))))))))).)))))…
RS 3 seq AAGAUCGGAAGAGGUGCGAAACUCAGGUAGUUAAUUGGAAAAGUCUAAGCUUUGAAGAUAAUUAGCGAGGGGAGUGAUCGCCGAGGAGUUAAUAUGCUUAGGACAUAUUACUUCGGUUGUUGAGGUUGAAUCCUUGCAAUUGUCACCAAUUAAGGGUGGAGAGCUUUCGGCAGU
RS 3 dot ……….(((……..)))………….((((..(((..((((((..(((((((.(((((((….(((((((((((…(((((((…….))))))))))))))……))))…))))))))))))))..)))…..)))..)))..))))……

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table