Detected as a riboswitch by 19 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA056337 Similarity: 0.947 Similarity: 0.947 Similarity: 0.947
UTR: 5HSAA056337
Gene: KIF18A
MFE: -43.973
ENS: 0.959
Length: 194.
Predicted Ligands:
lysine - 13/20
glucosamine - 5/20
cobalamin - 2/20
 RS: URS0000D88576_1313296
MFE: -65.324
Ligand: lysine
Species: Paenibacillus uliginis N3/975 Lysine riboswitch
 RS: URS0000C3811E_1441930
MFE: -72.702
Ligand: lysine
Species: Chania multitudinisentens RB-25 Lysine riboswitch
 RS: URS0000AB9806_525284
MFE: -64.658
Ligand: lysine
Species: Gardnerella vaginalis ATCC 14019 Lysine riboswitch
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA056337 URS0000D88576_1313296 URS0000C3811E_1441930 URS0000AB9806_525284
Length 194. 193. 194. 192.
Similarity - 0.947 0.947 0.947
Ensemble Norm 0.959 - - -
MFE -43.973 -65.324 -72.702 -64.658
Ligands - lysine lysine lysine
Gene KIF18A - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 8.016 8.001 5.
Length SE - 1. 0. 4.
Lev Distance - 65. 67. 63.
UBS 14. 14. 15. 12.
BS 0. 0. 0. 0.
ILL 4. 3. 2. 3.
ILR 3. 4. 3. 3.
H 5. 4. 6. 5.
BL 2. 4. 3. 2.
BR 3. 4. 4. 3.
UN 0.067 0.192 0.041 0.083

Sequences

Field Description
UTR seq + 25 gaagagcuuuaacuguuagucuugcacuggucaaucgggaaccccuccugagccccaguuguagguagcaucgagauaaaagccgcucugacugccuaacgggauugccgaggaucagaugagagaaguauucaaguauuuauacagauaggaaucaagauaaucaacaATGTCTGTCACTGAGGAAGACCTGT
UTR dot + 25 …(.(((((…(((((..((((((((((….((((((…..))))))…))))).))))))))))……..)))))).((((.(((((((..(((…..))))))..))).).))))((((((….))))))..(((((((………………..)))))))…..(((….)))..
RS 1 seq AGAUGAGGUAGAGGUUGCGAAUGUGAUUAGUAAACGUGCCGAGGUGAAGAGUCACCUAUGACGCACGCUUGAAAGGCAUUUUCGCCGAAGUGGACGGCUGUGCUCUUACACCGUCUGCUGGGUCCGAUCCCGAAAGGGACGGAACUGUCACGGGAGCCAAUCCUUACGCUUCCCGUGUUGUGCUAUCUUAAUG
RS 1 dot …………….(((((.(((..(..(((.(((((((((((((….)))))).))..))))).)))..)..))).)))))(..(((((((((.((((….)))))))))))))..)((((.((((….))))))))…..(((((((((……….))).))))))…………….
RS 2 seq CAAGCCAGAAGAGGCGCGUCGCCCAGGUAGAGUGUCAGAGGAGCCGUUAUCCGAUGACGGCACUGGAGGGGGAGCGACGCCGAGGCGUGAUGAAAGCGGCAAUCAUUAACGUCGGCUACAGGGGCUGAAUCCCCUGAGUUGUCACCAUGGGUCGCCUGUAAAGGCGGUCAGCAAGGUGGGGCGCUUCUGGGUGU
RS 2 dot …(((……)))(((((((((((((….(((((..(((…….)))..))))))).))))…….)))))))….(((((((((………)))))).)))(((((.((((((……)))))))))))(((((.((.(((((((….)))))).)..)).))))).(((((….)))))
RS 3 seq CACAUCGACCAGAGGUCGCGCUCAACAAGAGUAGCAAUCAUUAGCCAGAAAGAGGCGUUAAGUGAUUUGCAAAAGGGGAGAGCGCCGAAGUUUGUAGGUUAUUCUUUCUAGCUUACAAGCUGGGACUUGGCUUAAUAAGCCAAGGACUGUCGCAGCAAUUUUGGCAAUUUGCUGCGGAGUGCUAUCGACAUG
RS 3 dot …..(((((…)))))(((((..(…….(((((((((.(((…….)))….))))))).))……)..)))))((..(((((((((((((…….))))))))))))).)).((((((((…))))))))((((.(((((((((……….)))))))))))).)……….

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table