Detected as a riboswitch by 20 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA056345 Similarity: 0.957 Similarity: 0.957 Similarity: 0.956
UTR: 5HSAA056345
Gene: KIF18A_0
MFE: -27.705
ENS: 0.969
Length: 150.
Predicted Ligands:
TPP - 7/20
glucosamine - 6/20
FMN - 4/20
 RS: URS0000BF0F3E_708197
MFE: -45.466
Ligand: TPP
Species: Colletotrichum tofieldiae TPP riboswitch (THI element)
 RS: URS0000C6309B_1573173
MFE: -44.492
Ligand: TPP
Species: Colletotrichum incanum TPP riboswitch (THI element)
 RS: URS0000C62D9A_1232866
MFE: -51.756
Ligand: cobalamin
Species: Caballeronia udeis AdoCbl riboswitch
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA056345 URS0000BF0F3E_708197 URS0000C6309B_1573173 URS0000C62D9A_1232866
Length 150. 149. 149. 151.
Similarity - 0.957 0.957 0.956
Ensemble Norm 0.969 - - -
MFE -27.705 -45.466 -44.492 -51.756
Ligands - TPP TPP cobalamin
Gene KIF18A - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 8.001 8.002 12.
Length SE - 1. 1. 1.
Lev Distance - 54. 54. 54.
UBS 8. 8. 8. 9.
BS 0. 1. 1. 0.
ILL 4. 3. 3. 2.
ILR 3. 5. 5. 4.
H 3. 2. 2. 2.
BL 1. 1. 1. 2.
BR 0. 1. 1. 2.
UN 0.113 0.141 0.154 0.099

Sequences

Field Description
UTR seq + 25 gaauauugugguugagucugaagcgcugggaggcggacauuaaagugaagugguugcgguaaccuggccugggccugaaagaaguauucaaguauuuauacagauaggaaucaagauaaucaacaATGTCTGTCACTGAGGAAGACCTGT
UTR dot + 25 (((((((……..((((..((.((((((..(((..((((…….))))..)))…..))))))))))))……..)))))))……….(((((((………………..)))))))…..(((….)))..
RS 1 seq CAAUGCAUGAGCCGGUGCCCACCCGAUGCCGACGUCGCUGCCACCUCUCUCCAUGGUGACCAGCGGCCGAAGCCGACGGUGGGCUGAGAUUAUACGGCCUCGAACUUGAUCUGGGUAAUACCAGCGAAAGGAUCAUGCAACCUAACACG
RS 1 dot …((((((((((((((((((((….((….(((((((.((((………))))..)))))))….))….)))))))…….)).))))……(((…((((……))))…)))..)))))))……….
RS 2 seq CAACGCAUGAGCCGGUGCCCACCCGAUGCCGACGUCGCUGCCACCUCUCUCCAUGGUGACCAGCGGCCGAAGCCGACGGUGGGCUGAGAUUAUACGGCCUCGAACUUGAUCUGGGUAAUACCAGCGAAAGGAUCAUGCAACCUAACACC
RS 2 dot ….(((((((((((((((((((….((….(((((((.((((………))))..)))))))….))….)))))))…….)).))))……(((…((((……))))…)))..))))))………..
RS 3 seq GAAGUAAAAUGCGCGCUUACGACCCGUGGAAGCUGGUGCAAAUCCAGCACGGUCGCGCCACUGUGACCGGUUGCAGCGCAAACCGGAAGUCAGACCUCGGCGUCGUAUACCUCUUUCUGACAUUGGGGCGCGCACUCCCCGGGAGACAUUC
RS 3 dot ………(((((((((((((((((.((…(((((((…..((((.(((((((……)))))))))))….))..)))))……..)).))).))))))……………….))))))))((((…))))……

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table