Detected as a riboswitch by 12 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA056346 Similarity: 0.959 Similarity: 0.958 Similarity: 0.958
UTR: 5HSAA056346
Gene: KIF18A_1
MFE: -25.734
ENS: 0.815
Length: 152.
Predicted Ligands:
cobalamin - 9/20
FMN - 8/20
SAM - 1/20
 RS: URS0002333162_1618847
MFE: -37.987
Ligand: cobalamin
Species: Parcubacteria group bacterium GW2011_GWA2_47_8 Cobalamin riboswitch
 RS: URS0000DA4F78_1194090
MFE: -46.099
Ligand: SAM
Species: Aliifodinibius roseus SAM riboswitch (S box leader)
 RS: URS00023210C8_999541
MFE: -45.531
Ligand: cobalamin
Species: Burkholderia gladioli BSR3 Cobalamin riboswitch
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA056346 URS0002333162_1618847 URS0000DA4F78_1194090 URS00023210C8_999541
Length 152. 153. 151. 151.
Similarity - 0.959 0.958 0.958
Ensemble Norm 0.815 - - -
MFE -25.734 -37.987 -46.099 -45.531
Ligands - cobalamin SAM cobalamin
Gene KIF18A - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 13.009 7.008 19.014
Length SE - 1. 1. 1.
Lev Distance - 48. 52. 46.
UBS 11. 10. 11. 11.
BS 0. 0. 0. 0.
ILL 7. 4. 6. 4.
ILR 4. 3. 3. 5.
H 1. 2. 1. 1.
BL 3. 3. 4. 3.
BR 5. 4. 3. 2.
UN 0.112 0.209 0.020 0.232

Sequences

Field Description
UTR seq + 25 auauugugguugagucugaagcgcugggaggcggacauuaaagugaagugguugcgguaaccuggccugggccugaagugaagaaguauucaaguauuuauacagauaggaaucaagauaaucaacaATGTCTGTCACTGAGGAAGACCTGT
UTR dot + 25 ………….((((….(.((.((.((((((((((….(((….(((..(((..((((..(((………((((……))))……….))).)))).)))..)))..)))..)))))))))).)).))).))))….
RS 1 seq CAAAUCGGAAUCGCCCACCGUACAUUCGCAACUGAACAUUUUUCAUGGGGAAUGAGGUGUGAUGCCUCAACUGUCCCGCAACUGUGAUACGUGUCGCCUGCCGCCUAGAGGCGCCGCGUUAAGUCAGAUCGCCAUGGUGUUCACUCAUAACAC
RS 1 dot ……((……))…………….(((((((….(((((.((.(((((((((.((((((….((…(((…(((((….))))).))).))…)))))).))))))…)))..)).))))))))))))……….
RS 2 seq UUGUUAUCAAGAAAGGCUGAGGGAACAGGCCCGAAGACGCCUUAGCAACCGCUCUGCCCGGCGCAUGUUAAAGUAUACUGUAAUAAUUUAUUUGAUAUGCCGGGGAGGAAGGUGCUACGUCCUGCUCCAGUAGUCCGGAGGAAGAUAAAUA
RS 2 dot (((((.((……(((((..(((.((((…….(((…((((.(((..(((.((((((..((((((((………………)))))))))))))).)))..)))))))))))))).)))..)))))…..)).)))))…
RS 3 seq AGCAACACAAAACCAGACGAAUCCCCAUAAACGAACGACGAAUCGUGGAAGCCGGUGUAAAUCCGGCGCGAUCGCGCCGCUGUGACCGUUCGCGUCGGCCUCGCGCCCGCGCGACGGAAGCCAGACCUCCCUUCGUCGUGAAGAUCGGACC
RS 3 dot ………………………….(((((((((((..(.(((….(((.(…(((((((((..(((((((.(((((….))))).))))…)))..)))))..))))….).)))))))))))))))…..)))….

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table