Detected as a riboswitch by 7 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA056384 Similarity: 0.981 Similarity: 0.981 Similarity: 0.980
UTR: 5HSAA056384
Gene: KIF20B
MFE: -16.901
ENS: 0.802
Length: 97.
Predicted Ligands:
glycine - 12/20
TPP - 3/20
zmp-ztp - 2/20
 RS: URS0000C65A3B_767029
MFE: -24.
Ligand: TPP
Species: Pseudopropionibacterium propionicum F0230a TPP riboswitch (THI element)
 RS: URS0000DA3CA9_1938
MFE: -44.931
Ligand: zmp-ztp
Species: Streptomyces viridochromogenes ZMP/ZTP riboswitch
 RS: URS0000AB5580_500485
MFE: -19.759
Ligand: TPP
Species: Penicillium chrysogenum Wisconsin 54-1255 TPP riboswitch (THI element)
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA056384 URS0000C65A3B_767029 URS0000DA3CA9_1938 URS0000AB5580_500485
Length 97. 97. 97. 97.
Similarity - 0.981 0.981 0.980
Ensemble Norm 0.802 - - -
MFE -16.901 -24. -44.931 -19.759
Ligands - TPP zmp-ztp TPP
Gene KIF20B - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 7. 3. 11.
Length SE - 0. 0. 0.
Lev Distance - 23. 25. 22.
UBS 10. 9. 9. 9.
BS 0. 0. 0. 0.
ILL 5. 3. 5. 3.
ILR 3. 4. 4. 2.
H 1. 1. 1. 1.
BL 2. 3. 1. 4.
BR 3. 3. 3. 2.
UN 0.072 0.072 0.072 0.072

Sequences

Field Description
UTR seq + 25 auuguuugaauuugaaaacgguaacaucgcagugcugcucgcgggucuggcuagucaggcgaaguuugcagaATGGAATCTAATTTTAATCAAGAGG
UTR dot + 25 ….(((((..((((((..(((..((((((((.(((..((((..(.((….)).)..))))))))))).)).))..)))…)))))))))))…
RS 1 seq UCCAGAACGCCGGGGUGCCCCACCGAAAGGGGCUGAGAUCAAACUCGUCGAACCUGAUGCAGUUCGCACUGACGAAGGGAGCGCCAUGAACGUCGCG
RS 1 dot ….(.(((.((.((((((((..((..((((((((..((((………….)))).))))))…))..))..))).))))).))..))))…
RS 2 seq UCGACGGGCCGUGACUGGCGCGCUGGGAUGGACCAACCAUCGGGGAGCGGCCCCUGGACCGAGUCCAGACCGAGUGCCGUGCGCCUGGGCCGUACCG
RS 2 dot …((((.(((((..((((((..(((..((((((..(((..((((…..)))))))…).)))))..))).))))))..)))..)).))))….
RS 3 seq CUGCAUGAAGACCGGUGUUCGACUCUUGUCGUUCUGAGAAUAUACGGUUAAACUUGAUCUGGGUAAUUCCAGCGAAAGGACUCAAUGCGCUUUUUCU
RS 3 dot ……(((((..(((((..((.((((.(((..(((.((((.((((((((….)))))…))))))))))))).)))).))…)))))))))).

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table