Detected as a riboswitch by 11 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA056465 Similarity: 0.967 Similarity: 0.966 Similarity: 0.966
UTR: 5HSAA056465
Gene: KIF2C
MFE: -39.530
ENS: 0.874
Length: 140.
Predicted Ligands:
cobalamin - 18/20
TPP - 1/20
molybdenum - 1/20
 RS: URS000232D054_1736443
MFE: -58.382
Ligand: cobalamin
Species: Brevundimonas sp. Root1279 Cobalamin riboswitch
 RS: URS00023187FC_767434
MFE: -37.517
Ligand: cobalamin
Species: Frateuria aurantia DSM 6220 Cobalamin riboswitch
 RS: URS000232AE3D_36816
MFE: -63.535
Ligand: cobalamin
Species: Streptomyces caelestis Cobalamin riboswitch
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA056465 URS000232D054_1736443 URS00023187FC_767434 URS000232AE3D_36816
Length 140. 142. 141. 140.
Similarity - 0.967 0.966 0.966
Ensemble Norm 0.874 - - -
MFE -39.530 -58.382 -37.517 -63.535
Ligands - cobalamin cobalamin cobalamin
Gene KIF2C - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 17.001 9. 3.
Length SE - 4. 1. 0.
Lev Distance - 31. 40. 45.
UBS 11. 11. 12. 12.
BS 0. 0. 0. 0.
ILL 2. 2. 4. 2.
ILR 3. 6. 3. 2.
H 2. 2. 2. 2.
BL 5. 3. 3. 6.
BR 4. 2. 4. 4.
UN 0.064 0.092 0.078 0.043

Sequences

Field Description
UTR seq + 25 acgcuugcgcgcgggauuuaaacugcggcgguuuacgcggcguuaagacuucguaggguuagcgaaauugagguuucuugguauugcgcguuucucuuccuugcugacucuccgaATGATTGATTTTGATGATGTGGCTG
UTR dot + 25 ..((.(((.(((((……..))))))))))…((((.(((((((((((((.(((((((((((….((((…(.((……)).)..))))….))))))))))).))))…..).)))))))).))))….
RS 1 seq AAGGGAACGCGGUCCAACACCGCGGCUGUGCCCGCAACUGUAGGCGGCGAGGCCGUCAUUCGCUCCGGAGCUUCGGCUUCGGCGCCACUGGGCGACCGGGAAGGCGAGAAUGGCGGCUUUUGACCCGCAAGCCAGGAGACCU
RS 1 dot ..(((..((((((((……).))))))))))….((((..((((.((((((((((((((((((((.((((.(((……)))…))))..))))…)))))..)))))))))))….))))..)).))…….
RS 2 seq GCAAAUAUGCAAGCACGCAGGUGGCCGCUGGAUGUAUGAUCGGCGAAACAAGCGGGAAACAGGAAACCGGUGGAAAUCCGGUACGGUCGCGCCACUGUUAUCGAGUCAUCGAGAGUCAGACCCUGUUUCCAGUCCGCCAGU
RS 2 dot …..((((((..((.((.((…))))))..))))))…((((……((.(((((((((..((((((((….((((((((((……))))).)))).)))))))…))…..))))))))).)).))))…
RS 3 seq GCCCUUCCGGGACCGUGGUGGACUGCCUCAGCCACUACGGCGGCAGGAGAGGAAGCCGGUGCGAUUCCGGCGCGGUCCCGCCACUGUCACCGGGGUGAACACCCCGGGAGCCAGGAACUCUCACCGCCGGUCUCGUCGAA
RS 3 dot ..(((.(((…(((((((((.(((…))))))))))))))).))).((.((.(((((((.(((((((((……………((.(((((((….)))))))))))).))))…))..))))))).)).))…

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table