Detected as a riboswitch by 18 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA056517 Similarity: 0.974 Similarity: 0.972 Similarity: 0.972
UTR: 5HSAA056517
Gene: KIFAP3
MFE: -28.887
ENS: 0.922
Length: 118.
Predicted Ligands:
TPP - 5/20
cobalamin - 4/20
molybdenum - 3/20
 RS: URS0002322C26_478801
MFE: -50.624
Ligand: cobalamin
Species: Kytococcus sedentarius DSM 20547 Cobalamin riboswitch
 RS: URS0000DA8840_1122930
MFE: -34.197
Ligand: TPP
Species: Papillibacter cinnamivorans DSM 12816 TPP riboswitch (THI element)
 RS: URS0000AB9A42_903814
MFE: -27.883
Ligand: molybdenum
Species: Eubacterium limosum KIST612 Moco (molybdenum cofactor) riboswitch
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA056517 URS0002322C26_478801 URS0000DA8840_1122930 URS0000AB9A42_903814
Length 118. 117. 119. 118.
Similarity - 0.974 0.972 0.972
Ensemble Norm 0.922 - - -
MFE -28.887 -50.624 -34.197 -27.883
Ligands - cobalamin TPP molybdenum
Gene KIFAP3 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 7.018 7.001 3.004
Length SE - 1. 1. 0.
Lev Distance - 31. 34. 37.
UBS 6. 8. 7. 6.
BS 0. 0. 0. 0.
ILL 3. 3. 3. 3.
ILR 1. 2. 1. 0.
H 1. 2. 2. 1.
BL 1. 2. 2. 2.
BR 3. 3. 1. 2.
UN 0.195 0.060 0.168 0.136

Sequences

Field Description
UTR seq + 25 agagaauuauuuuaaaggguccuuuuaacugaaaucuccuuuguauuaagaugugcuacaugagcucaaacuaauuggaaagguggcaggauaATGCAAGGGGAGGACGCCAGATACC
UTR dot + 25 …………….((((((((………….(((((((((((…(.((((((……((((…..))))….)))))).).))))))))))))))))).))…….
RS 1 seq UGGUAGCCUCGCCGUCGAGGUCCGACGUGGGGAAAGCCGGUGGGAAUCCGGCACUGACCCGCAACCGUGAGGCGCGCGCGCCGCAGUCGGAUUGCCCGCCCGGACCUCGGCUCACAC
RS 1 dot .(((……)))(((((((((((…………..((((((((((((((..((.(.(((..((….))…))).).))..)))))))).)))))))))))))))))……
RS 2 seq AACUUAACACAGGGGUGCUGGAAGUCAUUUCCGGCUGAGAGGAAAGCAAAUGGCAGCUUUUAAACCCUUAAACCUGAUCCGGGUAAUGCCGGCGUAGGAAGAGCGUUCUUGUUUCUUCA
RS 2 dot …………….(((((((…..)))))))…((((.((((((..(((.((((((………..((((..((((……))))..))))))))))))).)))))))))).
RS 3 seq AAAGAUUUAUCUAUCCGAAUUUUUUAUCCUAAAGUCAAUCCAUGGAUUCAAAAUCGUCAGAGUGCAGCGGGAAACGGCUGUGCUUUCCAUUGUGAGAAGGAUAGAUGAUAAACGUGCG
RS 3 dot ……((((((((((….((((((………….(.(((((………….(((((((((.(….).)))))))))))))).)))))))))))))))))……….

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table