Detected as a riboswitch by 2 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA056635 Similarity: 0.974 Similarity: 0.974 Similarity: 0.974
UTR: 5HSAA056635
Gene: KIRREL3
MFE: -24.316
ENS: 0.
Length: 111.
Predicted Ligands:
SAM - 16/20
methionine - 2/20
TPP - 2/20
RS: URS0000C731E8_1121877
MFE: -41.720
Ligand: methionine
Species: Ferrimicrobium acidiphilum DSM 19497 S-adenosyl methionine (SAM) riboswitch,
RS: URS0000AB2BE4_283734
MFE: -21.801
Ligand: SAM
Species: Staphylococcus pseudintermedius SAM riboswitch (S box leader)
RS: URS0000D9854C_1078083
MFE: -22.101
Ligand: SAM
Species: Staphylococcus sp. HGB0015 SAM riboswitch (S box leader)
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA056635 URS0000C731E8_1121877 URS0000AB2BE4_283734 URS0000D9854C_1078083
Length 111. 112. 112. 110.
Similarity - 0.974 0.974 0.974
Ensemble Norm 0. - - -
MFE -24.316 -41.720 -21.801 -22.101
Ligands - methionine SAM SAM
Gene KIRREL3 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 6.001 6. 6.
Length SE - 1. 1. 1.
Lev Distance - 31. 32. 32.
UBS 9. 8. 8. 8.
BS 0. 0. 0. 0.
ILL 3. 1. 2. 2.
ILR 0. 1. 1. 1.
H 3. 3. 4. 4.
BL 3. 3. 2. 2.
BR 2. 2. 1. 1.
UN 0.117 0.089 0.134 0.136

Sequences

Field Description
UTR seq + 25 cggaggcugagcaccgagagccgccaaggaagagaaacuaaccacagccaaguuaccccgccggcuuuccuucgcugcgcuaaggaATGAAACCCTTCCAGCTCGATCTGC
UTR dot + 25 .((.((((……….)))).))…((((.(((………((((..((……)).)))))))))))((((.(..((((……..)))))))))………
RS 1 seq GCUCAAGAAUUCUGUCUUAAGCCCUCCGGCAUGACAGAAUGGCAACCGCUCCCGCAAGACGGUGCUACCGGAGGAAGAGCUGGUCGGUCUCGUUGAUCGGCAAGGCGGGAAG
RS 1 dot (((.((((……)))).)))(((((((……….((((.((((((……)).)))))))))))))))….(((.(((((((…..)))))))..)))……
RS 2 seq CUCUUAUCCUGAGUGGUGGAGGGACAUGGACCCAAUGAAACCCAGCAACCUCUUUUAACGAAGAAAGGUGCCAAACCGUUUGCAGACACAAUACUAGUCUGAACGAUAAGAG
RS 2 dot (((((..((…..))..)))))…(((…………)))((.((((.((((….)))).))))))…..((((..(((((………)))))))))…….
RS 3 seq CUCUUAUCCUGAGUGGUGGAGGGACAUGGACCCAAUGAAACCCAGCAACCUCUUUUAACGAAGAAAGGUGCCAAACCGUUUGCAGACAAAUAUGGUCUGAACGAUAAGAG
RS 3 dot (((((..((…..))..)))))…(((…………)))((.((((.((((….)))).))))))…..((((..(((((…….)))))))))…….

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table