Detected as a riboswitch by 1 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA056646 Similarity: 0.983 Similarity: 0.983 Similarity: 0.982
UTR: 5HSAA056646
Gene: KITLG
MFE: -3.127
ENS: 0.766
Length: 73.
Predicted Ligands:
fluoride - 13/20
SAM - 4/20
unknown - 1/20
 RS: URS0000D95BBF_1817756
MFE: -16.721
Ligand: SAM
Species: Candidatus Muproteobacteria bacterium RBG_16_62_13 SAM riboswitch (alpha-proteobacteria)
 RS: URS0000BF2801_1550400
MFE: -11.009
Ligand: SAM
Species: marine actinobacterium MedAcidi-G2A SAM riboswitch (alpha-proteobacteria)
 RS: URS0000BFDB68_471874
MFE: -11.797
Ligand: fluoride
Species: Providencia stuartii ATCC 25827 Fluoride riboswitch
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA056646 URS0000D95BBF_1817756 URS0000BF2801_1550400 URS0000BFDB68_471874
Length 73. 74. 74. 72.
Similarity - 0.983 0.983 0.982
Ensemble Norm 0.766 - - -
MFE -3.127 -16.721 -11.009 -11.797
Ligands - SAM SAM fluoride
Gene KITLG - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 3.056 1.017 3.001
Length SE - 1. 1. 1.
Lev Distance - 21. 22. 22.
UBS 3. 2. 3. 2.
BS 0. 0. 0. 0.
ILL 1. 0. 1. 0.
ILR 1. 0. 0. 0.
H 2. 2. 2. 2.
BL 0. 0. 0. 0.
BR 0. 0. 0. 0.
UN 0.562 0.324 0.432 0.528

Sequences

Field Description
UTR seq + 25 uuaaguguaaagaauaagggaguuaacgccaaaaauaaaugaacaaaaATGAAGAAGACACAAACTTGGATTC
UTR dot + 25 ………………((……..))…………………..(((..((……))..)))
RS 1 seq CCUGUAGUACGCGCCGAUUUGACGAUCAGCUUGCGGGCGCGAAAAAAAUGCCGCUAAAGCGAGUAAACCCGCUU
RS 1 dot ………((((((………………..))))))……………(((((……..)))))
RS 2 seq ACCAACAAAAAUCGUGAUUUGCCUGCUUGCCGCGAUUCAAAAUAAAGCGCUAAAAAGGGAGAAAUUUCCUAGGG
RS 2 dot ………(((((((….((……)))))))))……………….(((((….)))))….
RS 3 seq CUAACAAAAGGAGAUGGCAUUCCUCCUGUUUAAAAACCGUCCAAAUAAAGGGCUGAUGAUGCCUGCGUUCAC
RS 3 dot ……..(((((………)))))………………….((((…….))))……..

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table