Detected as a riboswitch by 3 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA056919 Similarity: 0.983 Similarity: 0.980 Similarity: 0.980
UTR: 5HSAA056919
Gene: KLHL13
MFE: -14.036
ENS: 0.757
Length: 87.
Predicted Ligands:
glycine - 8/20
TPP - 5/20
zmp-ztp - 3/20
 RS: URS0000836095_347256
MFE: -19.333
Ligand: TPP
Species: Mycoplasma hominis ATCC 23114 TPP riboswitch (THI element)
 RS: URS0000D6BC9B_12908
MFE: -38.059
Ligand: GMP
Species: unclassified sequences c-di-GMP-II-GAG riboswitch
 RS: URS0000BECBEE_12908
MFE: -14.925
Ligand: fluoride
Species: unclassified sequences Fluoride riboswitch
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA056919 URS0000836095_347256 URS0000D6BC9B_12908 URS0000BECBEE_12908
Length 87. 88. 86. 88.
Similarity - 0.983 0.980 0.980
Ensemble Norm 0.757 - - -
MFE -14.036 -19.333 -38.059 -14.925
Ligands - TPP GMP fluoride
Gene KLHL13 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 4.002 9.001 3.
Length SE - 1. 1. 1.
Lev Distance - 21. 23. 25.
UBS 5. 5. 5. 5.
BS 0. 0. 0. 0.
ILL 3. 2. 2. 3.
ILR 2. 1. 0. 3.
H 2. 2. 2. 1.
BL 0. 1. 0. 1.
BR 0. 1. 2. 0.
UN 0.161 0.205 0.186 0.159

Sequences

Field Description
UTR seq + 25 ucuuaguugguagucuguuauggaaacgcucuuuacuguuauuguaguaccguggugacaacATGGATCATCTGCATAGAGGGGAAT
UTR dot + 25 ………((..((……))..)).(((((((…….(((((..(((((…….)))))…..))))))))))))….
RS 1 seq UAUAAAGAACAGGGGUGCCUUUGGCUGAGAAAUACCCUCAUUAGCUGAUCUAGUUAAUACUAGCGUAGUGAGUGUCUUAGUUUUUUGC
RS 1 dot ……….(((….)))..((((((((……..((((.((((..(((((….)))))..)))).))))))))))))……
RS 2 seq UGACAUCGGGGAGGCGAUGACCUCCAGGCGGAACUCGGUCACCAAUCGCCCUGGGUGAGCCAGUGGUGAGACCGGGCCCGUUCACU
RS 2 dot ………(((((……)))))..((((..(((((((…..(((((((((…..)))).)))))))))))).))))…..
RS 3 seq UUUGGGCGCGGUGAUGGAGUUCACCAUCUACUACAAAUAUGGAAAACCGUCCAACUUCUUUAGCCGGACUAAUAACUCCUACCUAUAA
RS 3 dot ………((((..((((((…..(((.(((……((((……))))…….)))..)))…..))))))))))…..

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table