Detected as a riboswitch by 3 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA056952 Similarity: 0. Similarity: 0.898 Similarity: 0.895
UTR: 5HSAA056952
Gene: KLHL24_0
MFE: -86.213
ENS: 0.745
Length: 300.
Predicted Ligands:
cobalamin - 20/20 - 20/20


 RS: URS000232E33F_1777132
MFE: -117.733
Ligand: cobalamin
Species: Caballeronia peredens Cobalamin riboswitch
 RS: URS00023185F5_1798267
MFE: -155.483
Ligand: cobalamin
Species: Gammaproteobacteria bacterium RBG_16_66_13 Cobalamin riboswitch
 RS: URS0002334982_1801978
MFE: -79.375
Ligand: cobalamin
Species: Planctomycetes bacterium RIFCSPHIGHO2_12_42_15 Cobalamin riboswitch
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA056952 URS000232E33F_1777132 URS00023185F5_1798267 URS0002334982_1801978
Length 300. 300. 302. 301.
Similarity - 0.900 0.898 0.895
Ensemble Norm 0.745 - - -
MFE -86.213 -117.733 -155.483 -79.375
Ligands - cobalamin cobalamin cobalamin
Gene KLHL24 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 23.001 7.003 10.001
Length SE - 0. 4. 1.
Lev Distance - 121. 128. 135.
UBS 20. 20. 19. 18.
BS 2. 0. 2. 0.
ILL 5. 7. 5. 5.
ILR 5. 6. 3. 4.
H 6. 7. 7. 6.
BL 6. 4. 5. 6.
BR 7. 4. 7. 6.
UN 0.117 0.093 0.060 0.150

Sequences

Field Description
UTR seq + 25 guguucgccgagagguaccgggggugacagcuccgggaccggccgaaaggcgaggaaccggaagcccgggggagugcgaccgccucaaauccagccuucuuguuuggugggacgaccgucgguucuguccgggaggaaugacggggucaagguguggaaauuaaaagaacacacauauuuugacuggggcuuugaucaaccaaaugcuaaaaagccacauaaagaagaucccuaauagucauuucucaacaauuauauagucaacugauguaacaATGGTACTAATATTGGGACGCAGAC
UTR dot + 25 ((..((.(((……..))).))..)).(((((((..((.(((….)))..))..))))).))(((((((((..((((((.((((…((((.(…..).)))))))).))…)))).)))).)))))((((((((((((((((((((((((……………..)))))))))))((.((((((……………..)))))).))……….)))…..))))))))))……………..(((.(((..(((((…….)))))..))))))..
RS 1 seq UACACUUGCCGCACUUUUGGUGCUCGCAUUCGCGGAUCUCGCGAAUGCAGUCAAACGGGAAACAGGGAGCGAAGUCCUCGAAGCACACCGGGACGAGCCAACCUGUGCUGCCCCCGCAACGGUAAGCGACCGCAACGCAAGUUGCAAGUCGUCCCUUGCGCGUUUCUGCAUGACAGGCGCGUGUUUUCUCAUCACGCGAAACCACUGCAAGAAACGUGUCGAUGCCACUGCGCACGUUUGCGCGGGAAGGCGGGGCGAUGUGUCGCCAGCCCGGAUACCGGCCGGAGUUCGACGCGCACG
RS 1 dot ……….(((((…)))))..(((((((((…..)))))))))……..(((..(((((..((…((((.((……..))))))..))…)))))….))).(((((.((…(((((.(((((….)))))..))))).)))))))((((((((((…….((((((………))))))…….)))).))))))((((..((((.(((((((….)))))))…)))).))))..((((((..(((((((…….)))).)))))))))…..
RS 2 seq AACCGACCCCUGGGCAGGGGUGGCCUGUCGCCCGGAUGCGACGGCCGACGUUGGGGAAGCCGGUGACCGCCCGUUGGUGGAAGUCCGGCACUGUCCCGCAACUGUAAGGGCAGCUAUCAGCCGUCAGCCAUCAGCCGUCAGCUAGCGCUUUAGCUGACCGCUGAGAGCUGACACUUGCACCCCGUUCGGGCCGGGAGACCCGGUCCGCCGGGGCGAGACGGCCUGCGCUGCACUCCGGCGCAAGUGCAGGUGAAGCUGAAGGCUGUUCAAGUCAGGAUACCCGCCUCUGCCCCGGCGCUUGA
RS 2 dot …..((((((….))))))((((.(((((……))))))))).((((((((((.((((((..(((((….)))))..).)))))….)))).)))).))..((((((((.(((((.((((((..(((((.(((((((((….))))))))).)))))..)))))).(((((..((((..(((((((((…))))))))).)))))))))…(((((((((((……..))).))))))))…))))).))))))))…(((((…..((((……..)))))))))
RS 3 seq CAAUAGAUUACACAUACAGGUGUCUCAACAUAUCCAUUGGGACAAAAAGGGAAUCCCAGCUCCAUUUUUUAAAUGGAGAAAAGGGAACGGUACCGCCGCUGUAUUCGGUGACGAACGUUGCAGAAGCCACUAUCCUGAUUUAGUAAUUUAUCGCAGAGGACGCCGAGAGCACAGAGAAAAAAGACAAAAAAUAAUUAAUCUCUGCGUACUCUGUAUUCUGUGGUGAUUUAAAAAGGAUGGGAAGGUGCAAUCAGUAGGACGAACCGCCAGUCAGAAAACCUGCCUGUAAUAUUUUGCCGAA
RS 3 dot ………………..((((((((……..))))))))………((((..((((((((…))))))))….)))).((((…))))(((((((((….))))…)))))..(((.(((((((..(((((….(((((((((((.(((..(((.((.((((((…………………)))))).)).)))))).))))))))))).))))).)))))))…)))……….((.((((….(((.(((…..))).)))……))))))…

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table