Detected as a riboswitch by 20 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA056955 Similarity: 0.980 Similarity: 0.979 Similarity: 0.979
UTR: 5HSAA056955
Gene: KLHL24_1
MFE: -9.768
ENS: 0.978
Length: 86.
Predicted Ligands:
TPP - 5/20
zmp-ztp - 5/20
cyclic-di-GMP - 3/20
 RS: URS0000D792E7_1797566
MFE: -22.179
Ligand: glycine
Species: Burkholderiales bacterium RIFCSPLOWO2_12_FULL_61_40 Glycine riboswitch
 RS: URS0000D69AB7_256318
MFE: -26.889
Ligand: cyclic-di-GMP
Species: metagenome sequence Cyclic di-GMP-II riboswitch
 RS: URS000080E23F_32630
MFE: -28.237
Ligand: unknown
Species: synthetic construct TPP riboswitch (THI element)
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA056955 URS0000D792E7_1797566 URS0000D69AB7_256318 URS000080E23F_32630
Length 86. 87. 85. 87.
Similarity - 0.980 0.979 0.979
Ensemble Norm 0.978 - - -
MFE -9.768 -22.179 -26.889 -28.237
Ligands - glycine cyclic-di-GMP unknown
Gene KLHL24 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 2.040 5.016 17.035
Length SE - 1. 1. 1.
Lev Distance - 25. 25. 22.
UBS 5. 6. 6. 7.
BS 0. 0. 0. 0.
ILL 1. 2. 0. 4.
ILR 2. 2. 3. 4.
H 2. 2. 3. 2.
BL 1. 1. 2. 1.
BR 0. 0. 0. 0.
UN 0.326 0.126 0. 0.138

Sequences

Field Description
UTR seq + 25 ccacauaaagaagaucccuaauagucauuucucaacaauuauauagucaacugauguaacaATGGTACTAATATTGGGACGCAGAC
UTR dot + 25 ……..(((((((……..)))..))))………………(((.(((..(((((…….)))))..))))))..
RS 1 seq UGCAGGAGAGUGAACGCAUGCCGCGUUCCACCGAAGGCGCAAACUCCCAUGAACGCUCAGGUAUCCCACCCCAGGUGAUGUACUGCA
RS 1 dot ….((.((((((((((…..))))))…………..))))))……((…(((((..((((…))))..))))))).
RS 2 seq AUCGAUUUCGGAUGCCUUGAUCCGACCGCUGAAUGUGGGCACUUAGGCGGCCGGGGAGCAGGUAGUGCAACCGACCGUUCCGCAC
RS 2 dot …….((((((……))))))((((…..))))……..((((.(((((.(((…..)))..))..)))..))))..
RS 3 seq GCGACUCGGGGUGCCCUCCAUUGCACUCCGGAGGCUGAGAAAUACCCGUAUCACCUGAUCUGGAUAAUGCCAGCGUAGGGAAGUCGC
RS 3 dot ((..(.((((((((……..)))))))))..))………..((..(..((((..((((……))))..))))..)..)).

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table