Detected as a riboswitch by 9 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA057169 Similarity: 0.957 Similarity: 0.956 Similarity: 0.956
UTR: 5HSAA057169
Gene: KLRC1
MFE: -26.032
ENS: 0.870
Length: 163.
Predicted Ligands:
cobalamin - 12/20
Mg2+ - 3/20
glucosamine - 2/20
 RS: URS000232453D_1185325
MFE: -25.531
Ligand: cobalamin
Species: Lactobacillus coryniformis subsp. coryniformis CECT 5711 Cobalamin riboswitch
 RS: URS0000AB96E0_491076
MFE: -32.687
Ligand: Mg2+
Species: Lactobacillus crispatus JV-V01 M-box riboswitch (ykoK leader)
 RS: URS0000D91E69_329046
MFE: -24.710
Ligand: TPP
Species: Rhizoclosmatium globosum TPP riboswitch (THI element)
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA057169 URS000232453D_1185325 URS0000AB96E0_491076 URS0000D91E69_329046
Length 163. 163. 164. 162.
Similarity - 0.957 0.956 0.956
Ensemble Norm 0.870 - - -
MFE -26.032 -25.531 -32.687 -24.710
Ligands - cobalamin Mg2+ TPP
Gene KLRC1 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 21. 3. 9.005
Length SE - 0. 1. 1.
Lev Distance - 50. 57. 55.
UBS 8. 11. 8. 7.
BS 0. 0. 0. 0.
ILL 4. 5. 5. 3.
ILR 3. 6. 4. 2.
H 1. 1. 1. 2.
BL 2. 3. 1. 0.
BR 2. 3. 2. 3.
UN 0.129 0.147 0.134 0.198

Sequences

Field Description
UTR seq + 25 uaaugcaaaaugagcuccaauacucguucuccaccucacccuuuuaauugcacuagggaauccuguauauaaaccauuuauuaacuucuuaacuacuguuauuauagaguacagucccugacaucacacacugcagagATGGATAACCAAGGAGTAATCTACT
UTR dot + 25 ………….(((((…….(((.((((.(((…………….((((((…((((((……..(((((((((…………))))..)))))))))))))))))……………))).)))).)))…)))))……..
RS 1 seq CUUUAAUUAAAUAAUGACCAUUCAAGUGAUCCAAAGGAAACUAGUGUAAAUCUAGUGCUGUACCCGCAACUGUGAGAUGGACAAUGCAUAUAACCACGUUAGUUUGGAAGGAUAUGCGGCGAUUGAGAUCAAGUCAGGAUAUUUUGGUGAAUGGUAUACAGGC
RS 1 dot …………….((((((((……((((((.(..((…….(((((((((((((.((.(((…(((..(((………….)))..)))..)))…))…)))))).))).))))……))..).))))))))))))))……..
RS 2 seq CAAAUAAACUGUUAGGUGAGGCUCCUACGUGAACACAAGCUAUCGCCCGGAAACAUCCAGAGAUGCCAACGAGUAAAAUAGUUCUUGUCGAGAUAAGGCGAGAUCCAGAUAGCUAGCCUGUGCUUACGUCACGUAGUGUCAAAACUGAACGACGAGGAAACAUC
RS 2 dot ………(((..(((..(((..((((((((.(((((((((((….(((………………………….(((((((…….)))))))))).)))))))….))))……)))))))).)))…)))..)))………….
RS 3 seq UGUUUAGCAAGCGGGUGCCCCAUUUUUUGACGUUGUUUCUCUUCUUUUCCUUCUCAUUUACUCCUCGUUUCUUUUCUUCCUUCUCCCCAACGUCAGGCUGAGAUCAUACCGUUAAUACCCGAACAUGGUAAUGCAUGCGAGGGGAUUGCUUUUUAUAAUAAA
RS 3 dot ………((((((((..(((…((((((((((…………………………………………….)))))))))).)).)..))).)))))….(((…((((……))))…)))……………….

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table