Detected as a riboswitch by 9 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA057365 Similarity: 0.955 Similarity: 0.954 Similarity: 0.953
UTR: 5HSAA057365
Gene: KRIT1
MFE: -37.517
ENS: 0.865
Length: 161.
Predicted Ligands:
FMN - 7/20
cobalamin - 4/20
TPP - 2/20
 RS: URS0000D7A63C_1817832
MFE: -54.798
Ligand: FMN
Species: Candidatus Doudnabacteria bacterium RIFCSPHIGHO2_02_FULL_46_11 FMN riboswitch (RFN element)
 RS: URS0000C3E352_97139
MFE: -50.112
Ligand: TPP
Species: Clostridium sp. ASF502 TPP riboswitch (THI element)
 RS: URS0002329CDC_1860093
MFE: -38.373
Ligand: cobalamin
Species: Gammaproteobacteria bacterium MedPE Cobalamin riboswitch
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA057365 URS0000D7A63C_1817832 URS0000C3E352_97139 URS0002329CDC_1860093
Length 161. 161. 160. 162.
Similarity - 0.955 0.954 0.953
Ensemble Norm 0.865 - - -
MFE -37.517 -54.798 -50.112 -38.373
Ligands - FMN TPP cobalamin
Gene KRIT1 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 23.004 10.001 7.003
Length SE - 0. 1. 1.
Lev Distance - 49. 55. 58.
UBS 11. 11. 10. 11.
BS 0. 0. 0. 0.
ILL 2. 3. 4. 3.
ILR 4. 4. 4. 3.
H 2. 4. 2. 3.
BL 4. 1. 3. 4.
BR 5. 2. 3. 3.
UN 0.149 0.211 0.181 0.204

Sequences

Field Description
UTR seq + 25 aaagcuaaggccuuugaagaccugggaccccguaguuucgggagagggugaggggugaauggugcugaggugcgaggagagggaaggacaguaaagagcagagcgauuucauagccacgguaacggcgggguggcaATGGGAAATCCAGAAAACATAGAAG
UTR dot + 25 …(((…(((((((..(((((.(((((((.((.((((….)))).)).)))))……..)).))))……………..)..))))).))..)))..((((((.(((((…………))))).))))))……………….
RS 1 seq UUAAAUCUUCAGGGCGGGGUGAGCCUGGCCUUCGUAGCUUUAUGCGAAGUAGGCAAGUCCCCACCGGUAGUAAUCCCUUAUGGGUAGUCUACGAGGCCUUUGGCCAGGAGUGCUGUGCGAUUCAGCCGCCGACGGUAUAGUCCGGAUAAAAGAAGGUAUAA
RS 1 dot …………((.(((((..(((((..(((((((……))))))))))))..).)))).)).((((….(((….)))….))))..((((…)))).(((((((((((((…….)))..)))))))..)))………………
RS 2 seq UAAUGUACACAGGGGCGCUGUGAAACUGUUCCGGAGAGGUUUACCGCGGGAACAGGAUCUGCGGGACAGUUUCAAAACGGCUGAGAUGUAUGUGUUUUCAUACAGACCCUUUUAACUUGAUCCGGGUAAUGCCGGCGUAAGGAAAGGAGAAUUUCAUAAU
RS 2 dot ..((((((((..((.((…(((((((((((((.(((.((((…….))))….))).)))))))))))))…)).))..).)))))))…………..((((((..((((..((((……))))..))))))))))………….
RS 3 seq AUAAAUUAAGGUGCCUAAGGCUUGCUCAGUACAAUGUUAUUGUAUUAAUAGUGCUUAGGGUAAACGGGAAGUUAGGUGAUAAAACCCUACGCUGCCCCCGCAACGGUGAUUUAAAUGCAUUGCAUUUAACAGCCCGAUACCGGCCUCAAUUUCGUUUUUUAU
RS 3 dot ………..(((((.((((..(((.((((((((…))))))))…))))))).)))))…(((.(((((((.(……))))).))).)))(((…(((….((((((((…))))))))….)))….)))……………….

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table