Detected as a riboswitch by 1 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA057639 Similarity: 0.993 Similarity: 0.992 Similarity: 0.992
UTR: 5HSAA057639
Gene: L1CAM
MFE: -20.506
ENS: 0.742
Length: 45.
Predicted Ligands:
preQ_1 - 17/20
SAM - 3/20

 RS: URS0000ABB587_545693
MFE: -7.282
Ligand: preQ_1
Species: Bacillus megaterium QM B1551 PreQ1 riboswitch
 RS: URS0000C2926C_1263074
MFE: -5.399
Ligand: preQ_1
Species: Dorea longicatena CAG:42 PreQ1 riboswitch
 RS: URS0000AB4607_176090
MFE: -5.399
Ligand: preQ_1
Species: Streptococcus sinensis PreQ1 riboswitch
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA057639 URS0000ABB587_545693 URS0000C2926C_1263074 URS0000AB4607_176090
Length 45. 45. 45. 45.
Similarity - 0.993 0.992 0.992
Ensemble Norm 0.742 - - -
MFE -20.506 -7.282 -5.399 -5.399
Ligands - preQ_1 preQ_1 preQ_1
Gene L1CAM - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 2. 1.008 1.008
Length SE - 0. 0. 0.
Lev Distance - 9. 11. 11.
UBS 2. 2. 2. 2.
BS 0. 0. 0. 0.
ILL 0. 0. 0. 0.
ILR 0. 1. 0. 0.
H 1. 1. 1. 1.
BL 1. 0. 1. 1.
BR 0. 0. 1. 1.
UN 0. 0. 0.289 0.289

Sequences

Field Description
UTR seq + 25 gcgcggugccgccgggaaagATGGTCGTGGCGCTGCGGTACGTGT
UTR dot + 25 .((((((((((.(((………)))))))))))))……..
RS 1 seq GUUUACGUGGUUCGUAACCAUCCCACGUUAAAAAACUAAGGAGAG
RS 1 dot ((((((((((…………))))))….))))………
RS 2 seq UUUGAACUGGUUCGCAAACCUCCCAGUAUAAAAAACUAGGCAAAG
RS 2 dot ((((.(((((…………))))).))))………….
RS 3 seq UUUGGACUGGUUCGCAAACUUCCCAGUAUAAAAAACUAAGUACCC
RS 3 dot ((((.(((((…………))))).))))………….

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table