Detected as a riboswitch by 13 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA057684 Similarity: 0.941 Similarity: 0.938 Similarity: 0.937
UTR: 5HSAA057684
Gene: L3MBTL4
MFE: -72.177
ENS: 0.769
Length: 206.
Predicted Ligands:
cobalamin - 19/20
FMN - 1/20

 RS: URS0002316BDE_391937
MFE: -85.523
Ligand: cobalamin
Species: Nitratireductor sp. Pht-3B Cobalamin riboswitch
 RS: URS0002315E33_1739394
MFE: -66.422
Ligand: cobalamin
Species: Porphyromonas sp. HMSC065F10 Cobalamin riboswitch
 RS: URS000232A474_1803507
MFE: -70.185
Ligand: cobalamin
Species: Alphaproteobacteria bacterium 13_2_20CM_2_64_7 Cobalamin riboswitch
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA057684 URS0002316BDE_391937 URS0002315E33_1739394 URS000232A474_1803507
Length 206. 206. 205. 204.
Similarity - 0.941 0.938 0.937
Ensemble Norm 0.769 - - -
MFE -72.177 -85.523 -66.422 -70.185
Ligands - cobalamin cobalamin cobalamin
Gene L3MBTL4 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 13. 9.003 7.009
Length SE - 0. 1. 4.
Lev Distance - 71. 76. 74.
UBS 13. 14. 14. 15.
BS 2. 0. 2. 3.
ILL 5. 3. 6. 6.
ILR 5. 4. 4. 5.
H 3. 4. 4. 4.
BL 6. 5. 4. 6.
BR 5. 4. 4. 5.
UN 0.150 0.131 0.098 0.054

Sequences

Field Description
UTR seq + 25 aagaaggacgccgccgcccgcgugggauggucgcgagcccgcgugggugcccacggccgccgccgcgcgggguggccccauccccgggcagauugcuaugcuaugccuuguaugacuaagaccucuuaccaagaauacgugucagaccauaaaaccacugccaaggagugcggggguggcaATGAAACAGCCCAACAGGAAAAGGA
UTR dot + 25 ………((((((.((((((..((((((..((.(.(((((((((..((……..))..))))))))).).)).))))))((.(((((…..((((…((.(.(((((…((((….))))……))))).).))…))))……)))))..))..))))))))))))………..((….))…….
RS 1 seq AUCACGCUUGAGGUGCUCCAUCGGUGCCGUGCAUCGCACCGGGAGAAAAGGGAAUGCGGAACGGCGCCGACAGAACGCCCGAGCCGCAGCUGCCCCCGCAACUGUGAGCGCUGAGGUUCCCCGAUUGCCACUGGGCCGCAGGCCUGGGAAGGCGGGGAAACCGUUGAAGCGUCAGCCAGGAAACCUGCCUCGAGCCGUCACCUUCC
RS 1 dot …..(((((.((((.((..((((((((((…(((((((……….))..))))).))))))))))..)).)))))))))(((((.(((….))).)))))…(((((.(((((((….(((.(((((((…)))))))…))))))))……….)).)))))((((…))))……………….
RS 2 seq AUGUACCUUUGCAGUGACGGUGAUCCGAUGGACACUCGCUCAUCGGAGUAAGAGGGAAACAGGUGCAAGUCCUGUGCAGACCCGCUGCUGUAAGUCUCCAACCGAUCGGCUCGAAGUGAUGCCACUGUGGUCCUCCUCGGAGGAGUAUGGGAAGGCGACGAGCCGAGAGACAAGCCAGAAAACCUGCCGUCACGUGCAUUUUGUA
RS 2 dot ………(((((((((((….(((((((……..)))))))(((.((.(((..(((((…….)))))…..))).)))))((..(((((…….((((((((..((..(.(((…((.(((((….))))).))))).)..))..)))))))))))))..))(((…..)))))))))).))))…….
RS 3 seq UAUAGUCGUGCGGUCGUCGAUGCCCACCUCGGUGGGACGAAAAAGGGAACGCGGUGAGGGCUUUGUCCGAAGCCGCGGCUGCCCCCGCAACUGUGAGCGGCGAGCUUCACUCGGUCAGCCACUGGAGCCUACGGGAUGCUCCGGGAAGGCGGAGGAAAGCAGCGACCCGCGAGCCAGGAGACCUGUCGACGAUGCCAACCGUAA
RS 3 dot ….((((((.((((((((.(((.(((….(((((……..((.(.((((((..((((…))))…))))))..).)))))))….))).))).)))((((..(((.(((..((..((((((………))))))))..))).)))..))))..)))))))))).)((((…))))…(((……..)))..

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table