Detected as a riboswitch by 20 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA057962 Similarity: 0.957 Similarity: 0.957 Similarity: 0.953
UTR: 5HSAA057962
Gene: LARP7
MFE: -30.747
ENS: 0.973
Length: 157.
Predicted Ligands:
Mg2+ - 6/20
FMN - 4/20
glucosamine - 4/20
 RS: URS0000AB8D67_638301
MFE: -44.230
Ligand: Mg2+
Species: Granulicatella adiacens ATCC 49175 M-box riboswitch (ykoK leader)
 RS: URS0000BA205F_351656
MFE: -39.082
Ligand: molybdenum
Species: Xenorhabdus vietnamensis Moco (molybdenum cofactor) riboswitch
 RS: URS0000C81E91_1415775
MFE: -42.691
Ligand: Mg2+
Species: Clostridium baratii str. Sullivan M-box riboswitch (ykoK leader)
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA057962 URS0000AB8D67_638301 URS0000BA205F_351656 URS0000C81E91_1415775
Length 157. 156. 157. 157.
Similarity - 0.957 0.957 0.953
Ensemble Norm 0.973 - - -
MFE -30.747 -44.230 -39.082 -42.691
Ligands - Mg2+ molybdenum Mg2+
Gene LARP7 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 12.005 6.006 5.003
Length SE - 1. 0. 0.
Lev Distance - 51. 56. 61.
UBS 11. 11. 11. 10.
BS 0. 0. 0. 0.
ILL 3. 2. 3. 3.
ILR 3. 2. 3. 2.
H 3. 4. 5. 4.
BL 1. 4. 2. 2.
BR 2. 2. 3. 3.
UN 0.083 0.154 0.159 0.134

Sequences

Field Description
UTR seq + 25 aggauccggagacggaaauguccgaaggccgcaguacuugacccuguauuuugggagucgaacggagauaaucuggcccuguguuuuaaaagguacaaagaaacuaaagcuaugaucccuaacauagaaggaATGATCCCTAACATAGAAGGAATGG
UTR dot + 25 .(((((((….))))….)))…((((((.((..(((((((((…..)))).))))))).)……..)))))(((((((…..(((………………..(((((((……..)))…))))))))))))))………
RS 1 seq AUAGUAAAUCGGUAGGUGAGACUACCAUGGAGAUACGGAUGACUACCGCAAAAUAGUGGAGACACUAUUCGUUGGUCAGCAGCCUCUGUCGUGAAGGCAGAGACUAAUGUCAUUUCAUCGCUCCAUGAUGUUAAAGCUUGGACGAGAAUAUAAGAA
RS 1 dot …(((..(((((((……)))))…))..)))…((((((.((…(((((((….))))))))).))))))..((.(((((((…..))))))).))……..(((.(((.((((………….))))))))))……..
RS 2 seq AACGGAUAUUAACUCCUAGCCUCUGUGUCUAAGUCGUUGUUCUAUCAAAUGGAUAUCACAUUGAUAUGAUGCUCUGGCCGUGGCUCCUGAGUCACCAGGAUGCAAGGUAGAAAUGCCGGCAUCUCCCGUACUUGGAAGGUGUUAUUGUGGAACAACU
RS 2 dot …(((…….)))..(((…(((((…((((.(((..((((…..))))..))).))))..)))))…)))….(((((((……))))).))..((((….))))(((((((.(((….))).)))))))…………..
RS 3 seq UAAUAUUCUCGGUAGGUGAGGCUACCAUAGGGAUACGGGUUGCUGCCGCGAAAUAGUGGAGACACUAUUAGAUGGUCAACAGAAUAUGUCGAAGUUAAGGCUUAUUUUAAUGCAAUUUCAUUGCCCUACGGAGUUGAAGCUUGAACGGGCAGUUUAA
RS 3 dot …((((((.(((((……)))))…))))))…((((..(((((..(((((((….))))))).).))))))))((((((.(((……..))).))))))………..(((((((….((((….))))….)))))))….

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table