Detected as a riboswitch by 20 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA057963 Similarity: 0.979 Similarity: 0.979 Similarity: 0.979
UTR: 5HSAA057963
Gene: LARP7_0
MFE: -24.168
ENS: 0.956
Length: 106.
Predicted Ligands:
SAM - 16/20
tetrahydrofolate - 3/20
TPP - 1/20
 RS: URS0000AB2C5C_420246
MFE: -32.682
Ligand: SAM
Species: Geobacillus thermodenitrificans NG80-2 SAM riboswitch (S box leader)
 RS: URS0000AB70FD_235909
MFE: -32.682
Ligand: SAM
Species: Geobacillus kaustophilus HTA426 SAM riboswitch (S box leader)
 RS: URS0000D7AC40_1586290
MFE: -32.682
Ligand: SAM
Species: Geobacillus sp. B4113_201601 SAM riboswitch (S box leader)
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA057963 URS0000AB2C5C_420246 URS0000AB70FD_235909 URS0000D7AC40_1586290
Length 106. 105. 105. 105.
Similarity - 0.979 0.979 0.979
Ensemble Norm 0.956 - - -
MFE -24.168 -32.682 -32.682 -32.682
Ligands - SAM SAM SAM
Gene LARP7 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 5.006 5.006 5.006
Length SE - 1. 1. 1.
Lev Distance - 25. 25. 25.
UBS 7. 7. 7. 7.
BS 0. 0. 0. 0.
ILL 1. 2. 2. 2.
ILR 1. 2. 2. 2.
H 4. 3. 3. 3.
BL 2. 1. 1. 1.
BR 0. 1. 1. 1.
UN 0.189 0.267 0.267 0.267

Sequences

Field Description
UTR seq + 25 guggcugccagaagauagcgaacucaagcaccacauaccgacagaccgcauguaugacaguggucccauaagauuauaggaATGATCCCTAACATAGAAGGAATGG
UTR dot + 25 ((((.(((..((………..))..)))))))………((((((.(((…)))))))))……((((((….))))))(((……..)))…..
RS 1 seq GUCUUAUCAAGAGUGGGCGAGAGAACGGGCUUGAUGACCCCACAGCAACCUGCCGCUGGCAAGGUGCUAAAACCCGCAAAGCGAGUUCGCUUUGGAUGAUAAGAA
RS 1 dot …((((((((..((..(….)..))..))))))))……(((.(((((((…)))).))))))……..(((((((….)))))))………..
RS 2 seq GUCUUAUCAAGAGUGGGCGAGAGAACGGGCUUGAUGACCCCACAGCAACCUGCCGCAGGCAAGGUGCUAACACCCGCAAAGCGGUUUCGCUUUGGAUGAUAAGAA
RS 2 dot …((((((((..((..(….)..))..))))))))……(((.(((((((…)))).))))))……..(((((((….)))))))………..
RS 3 seq GUCUUAUCAAGAGUGGGCGAGAGAACGGGCUUGAUGACCCCACAGCAACCUGCCGCUGGCAAGGUGCUAACACCCGCAAAGCGAUGUCGCUUUGGAUGAUAAGAA
RS 3 dot …((((((((..((..(….)..))..))))))))……(((.(((((((…)))).))))))……..(((((((….)))))))………..

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table