Detected as a riboswitch by 20 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA057965 Similarity: 0.973 Similarity: 0.972 Similarity: 0.972
UTR: 5HSAA057965
Gene: LARP7_1
MFE: -22.579
ENS: 0.944
Length: 119.
Predicted Ligands:
molybdenum - 12/20
glycine - 4/20
FMN - 2/20
 RS: URS0000C1B1B5_1262894
MFE: -31.913
Ligand: FMN
Species: Eubacterium sp. CAG:841 FMN riboswitch (RFN element)
 RS: URS0000AB62A6_903814
MFE: -31.854
Ligand: molybdenum
Species: Eubacterium limosum KIST612 Moco (molybdenum cofactor) riboswitch
 RS: URS0000C48DBA_1121915
MFE: -39.281
Ligand: molybdenum
Species: Geoalkalibacter ferrihydriticus DSM 17813 Moco (molybdenum cofactor) riboswitch
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA057965 URS0000C1B1B5_1262894 URS0000AB62A6_903814 URS0000C48DBA_1121915
Length 119. 119. 118. 119.
Similarity - 0.973 0.972 0.972
Ensemble Norm 0.944 - - -
MFE -22.579 -31.913 -31.854 -39.281
Ligands - FMN molybdenum molybdenum
Gene LARP7 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 6.025 5.016 4.001
Length SE - 0. 1. 0.
Lev Distance - 34. 35. 37.
UBS 7. 8. 8. 8.
BS 0. 0. 0. 0.
ILL 1. 0. 2. 2.
ILR 1. 1. 2. 1.
H 4. 4. 3. 5.
BL 2. 2. 3. 1.
BR 1. 3. 1. 1.
UN 0.118 0.277 0.246 0.092

Sequences

Field Description
UTR seq + 25 ugguuuuuagcacuuaacugguucccuuauuuacagucaagcaccacauaccgacagaccgcauguaugacaguggucccauaagauuauaggaATGATCCCTAACATAGAAGGAATGG
UTR dot + 25 ((((……..(((.((((………….)))).)))……..))))…((((((.(((…)))))))))……((((((….))))))(((……..)))…..
RS 1 seq AAAAAUCUUUGGGGAAUGGUGUAAAUCCAUACCGGCAGUUAUAGUCUGCGAACGCCUUCGGGCGCCGAUGAGGUGAAACUCCUCAACCGACGGUACAGUCCGGAUGAGAAAAGAUUUGC
RS 1 dot …………((.((((…….)))).)).((((…….))))…(((((((((…))))..)))))……((((.(((((……))).)).))))………..
RS 2 seq AAUUAAAUAUGCAUUCGAGUCUAUAGGCCUAAAGGAAGUCCCAUGGCUGCGGACCGAUGAGUGUAGGGGGAAACGCCUGCGCUUUCCGUAUUUGAGAAGAAUGCAAUUGAGCUGUUUG
RS 2 dot ………..((.(((.((((…((((….((….))…))))..)))))))))((((((((.(….).))))))))….((((((…..))))))…………..
RS 3 seq UGUAAAAAAUUGCUCCGAGCCAUUCGACCUAAGGAUUUACGUCUAGGGUCCUUGGCCAAUGGGUUUCGCUGGAAACGGCGGAGCCUCCCUUUCGGAAAGGAGACAAAGCGAUCUGUCAC
RS 3 dot .((((….))))…(.((((…(((((..((((….)))).)))))..)))))…(((((((((((….))))))))))).(((((…))))).((((……..))))..

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table