Detected as a riboswitch by 20 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA057974 Similarity: 0.981 Similarity: 0.980 Similarity: 0.979
UTR: 5HSAA057974
Gene: LARP7_2
MFE: -16.554
ENS: 0.931
Length: 86.
Predicted Ligands:
fluoride - 5/20
glycine - 4/20
cyclic-di-GMP - 2/20
 RS: URS0000C46B43_632773
MFE: -13.354
Ligand: cyclic-di-GMP
Species: Bacillus beveridgei Cyclic di-GMP-II riboswitch
 RS: URS0000C5BF7F_1262966
MFE: -18.601
Ligand: glycine
Species: Ruminococcus sp. CAG:724 Glycine riboswitch
 RS: URS0000C6BD05_1262914
MFE: -15.368
Ligand: fluoride
Species: Phascolarctobacterium sp. CAG:207 Fluoride riboswitch
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA057974 URS0000C46B43_632773 URS0000C5BF7F_1262966 URS0000C6BD05_1262914
Length 86. 85. 86. 86.
Similarity - 0.981 0.980 0.979
Ensemble Norm 0.931 - - -
MFE -16.554 -13.354 -18.601 -15.368
Ligands - cyclic-di-GMP glycine fluoride
Gene LARP7 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 3.002 2. 7.003
Length SE - 1. 0. 0.
Lev Distance - 23. 27. 26.
UBS 5. 4. 6. 3.
BS 0. 0. 0. 0.
ILL 1. 0. 1. 0.
ILR 1. 1. 1. 0.
H 3. 3. 3. 3.
BL 0. 0. 0. 0.
BR 1. 0. 2. 0.
UN 0.314 0.271 0.302 0.372

Sequences

Field Description
UTR seq + 25 ggagacggaaauguccgaaggccgcaguacuugacccuguauuuugggagucgaacggagaATGATCCCTAACATAGAAGGAATGG
UTR dot + 25 ((…((((….))))….))…….(((((((((…..)))).)))))..(((……)))………………
RS 1 seq UAAAAAAUUGGAUGCGAUGAAGAAAUGGGUACUAUGUGGGCACUUAACCAUUUCGGAGCAAGUAGUGCAACCGGCCGGACGAAUC
RS 1 dot ……((((….))))……….(((((((((((……..))))……….)))))))…((……))….
RS 2 seq ACAGAGAACUCUGGAGAAACCCGUUUGGGUGCCGAAGGUGCAAGGCAAAAGCCGAAUCUCUCAGGCAAAAGGACAGAGCAAAUUUU
RS 2 dot .((((….))))……(((….)))((((((((((….(((….)))..)))).)).))))……………….
RS 3 seq GUAAUAAAAGGGAAUGGGGUACUCCCUAAAUGACUUUAGUCGUUUGAACCGCUUAGAGUUGAUAAGCUGAUGACUUCUGCCGUGUA
RS 3 dot ………((((………))))((((((((….))))))))….(((((…….)))))……………….

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table