Detected as a riboswitch by 20 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA058361 Similarity: 0.954 Similarity: 0.952 Similarity: 0.951
UTR: 5HSAA058361
Gene: LBR
MFE: -65.994
ENS: 0.987
Length: 168.
Predicted Ligands:
cobalamin - 11/20
FMN - 6/20
molybdenum - 1/20
 RS: URS0000AB3109_585503
MFE: -44.108
Ligand: molybdenum
Species: Selenomonas noxia ATCC 43541 Moco (molybdenum cofactor) riboswitch
 RS: URS000231BD38_1487921
MFE: -29.692
Ligand: cobalamin
Species: Clostridium sp. HMP27 Cobalamin riboswitch
 RS: URS0002330718_1078020
MFE: -65.983
Ligand: cobalamin
Species: Mycobacterium thermoresistibile ATCC 19527 Cobalamin riboswitch
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA058361 URS0000AB3109_585503 URS000231BD38_1487921 URS0002330718_1078020
Length 168. 167. 169. 169.
Similarity - 0.954 0.952 0.951
Ensemble Norm 0.987 - - -
MFE -65.994 -44.108 -29.692 -65.983
Ligands - molybdenum cobalamin cobalamin
Gene LBR - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 15.001 3.006 12.002
Length SE - 1. 1. 1.
Lev Distance - 52. 62. 59.
UBS 12. 11. 12. 14.
BS 0. 0. 0. 0.
ILL 1. 1. 1. 0.
ILR 1. 1. 2. 3.
H 4. 5. 5. 5.
BL 6. 4. 5. 5.
BR 4. 1. 4. 5.
UN 0.119 0.084 0.195 0.077

Sequences

Field Description
UTR seq + 25 gcgcccggcuugcgggacugcggggcgcgagagcgcggccggguagcgucgcgcgcguggaucugccgccggguugcugugcgacuauucuccgggagccguccgugucaccgccggaaccuggcgcagguuaauuauagaaaATGCCAAGTAGGAAATTTGCCGATG
UTR dot + 25 ((((((.((……….)).))))))..(.((((((((…..).))))))).)…((((((.(((((((((.(((.(((………((((…..))))……)))))))))))))))))))))…………((.(((((…..))))).))…
RS 1 seq UUUGUUCCGCGUUUCCGAGCAAAAAUAUCUAAGGACGACGGAUAUGCCGCCUGUAGCCUAUGAUAUUGCGUCUGCACUGCGGAGACGAAAUCUCCGAGAUGUGCACCGGGUUCAUGCAGAAAUGUCUGGGCCUUCCCGUAUUGAAAAGGAAGCGGCAGAAUUGCUAC
RS 1 dot (((((((………)))))))……..(((.((.((….)).)))))…(((((.((((((…((((((((.((((((…..))))))))…………….)))))))))))))))))(((((………..))))).((((….))))..
RS 2 seq AAUUGAUAUAUAGUUAUAGGUUAUGAAUUAAAAGGGAAGUCAGGUGAAAAUCCUGCACGGUCUCGCCGCUGUAAAAGAGGAGUCUUUAUAUAAUACCACUGGGAAACUGGGAAGGUUAUAAAGGCGAUGAUACUUAAGUCAGAAUACCUGCCUAUAAUAAUACACAAUU
RS 2 dot ..(((((.(((((…….))))).)))))..((((.((((((…….)))).))..)))).((.((…..)).)).(((((((((….(((.((((….))))…))))))))))))………..((.(((…..))).))…………….
RS 3 seq UGGCGGAUCCCUCCACGGACCGUCAUGAGAGGGAACCCGGUGAGAGUCCGGGACUGUCCCGCAGCGGUGUGCAGGAACGACCGCCGUCAUCGGCACUGGCCCGCAAGGGCUGGGAAGCGACGGCCAGUAGGAACCGAAGACGAAUGCCUGCGAGUCCGAAGACCUGCCG
RS 3 dot ((((((.(((……)))))))))…(.((((.(((((…….)))))….)))).).(((((((……)).)))))((((.(((((((((((((((…………)))..))))))).)…)))).))))…….(((.(((….))).)))..

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table