Detected as a riboswitch by 20 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA058362 Similarity: 0.961 Similarity: 0.958 Similarity: 0.957
UTR: 5HSAA058362
Gene: LBR_0
MFE: -35.886
ENS: 0.977
Length: 151.
Predicted Ligands:
SAM - 9/20
cobalamin - 5/20
FMN - 4/20
 RS: URS0002317DC8_1834150
MFE: -53.068
Ligand: cobalamin
Species: Mycobacterium sp. E787 Cobalamin riboswitch
 RS: URS0000C7AAC3_698760
MFE: -67.833
Ligand: SAM
Species: Streptomyces turgidiscabies Car8 SAM riboswitch (S box leader)
 RS: URS000231DB6E_1211777
MFE: -44.786
Ligand: cobalamin
Species: Rhizobium mesoamericanum STM3625 Cobalamin riboswitch
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA058362 URS0002317DC8_1834150 URS0000C7AAC3_698760 URS000231DB6E_1211777
Length 151. 150. 152. 151.
Similarity - 0.961 0.958 0.957
Ensemble Norm 0.977 - - -
MFE -35.886 -53.068 -67.833 -44.786
Ligands - cobalamin SAM cobalamin
Gene LBR - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 8. 2.003 17.004
Length SE - 1. 1. 0.
Lev Distance - 48. 55. 51.
UBS 10. 12. 10. 12.
BS 0. 0. 0. 0.
ILL 3. 4. 3. 3.
ILR 5. 6. 5. 5.
H 2. 2. 3. 2.
BL 2. 3. 2. 4.
BR 2. 3. 1. 5.
UN 0.066 0.067 0.125 0.126

Sequences

Field Description
UTR seq + 25 uguguuucgguguguaacgcauaaaacuucuuguuccacgcuccgcgguguuggggauuuucuacugcaucucgacagcaucucggguaacaaccgagccccuccucgcagcguuaauuauagaaaATGCCAAGTAGGAAATTTGCCGATG
UTR dot + 25 …….(((.((((…(((……….)))…)))).)))((((…..(((((((((((((((((((((.((…(((((…….)))))…))..))).))……………))))..))))))))))))))))…
RS 1 seq AGAGGGAACCCGGUGGGAGUCCGGGACUGUCCCGCAGCGGUAUGCAGGAACGACCGCCGUCACAAGCACUGGUCUGAGAAACAUCGGAGACCGGGAAGCGACGGCCACUAGGAGCACCACCGCGGUGCGCGCCUGCGAGUCCGAAGACCU
RS 1 dot .(.((((.(((((…….)))))….)))).)..(((..((((((..(((((((((((….((.(((((((..((….))..)))))))…))))))))………………))).))..))))).)..)))…….
RS 2 seq CGCUCAUCCAGAGGGGCAGAGGGAUACGGCCCGAUGAAGCCCCGGCAACCCUCCAGUCGGCACUCGUGAUCCAUUGACGGAUCGCGAGGCUCCCGGCUCGGGAAGGUGCCAAAUCCGUCUCAUGGCGAAACGCGUCGUGAGAAAGAUGAGGA
RS 2 dot …………((((((..(((……)))..)…)))))(((.(((.(((((((((..((((((((((……))))))))))….))))))..))).))))))..(((..((((((((((…..))))))))))..)))…..
RS 3 seq GCAUGAAGUCUCGUUGACAGGUACGAGGCGGCAGAUAUAACGGUUAUGUUGUGGGUUUGGAAACCGGUGAAAUUCCGGUGCGGUCGCGCCACUGUGAUCAGGAUGAGGAUACCUCGGACUGGAAGUCAGACCCUGCCACACAACGAUUCUC
RS 3 dot …((..(((((((……..)))))))..))………(((.(((.((((((((((…(((((((…(((.((.(((((((……)))))).).))..)))….))..)))))…)))))))).)).))).)))…….

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table