Detected as a riboswitch by 15 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA058364 Similarity: 0.951 Similarity: 0.946 Similarity: 0.942
UTR: 5HSAA058364
Gene: LBR_1
MFE: -85.429
ENS: 0.855
Length: 199.
Predicted Ligands:
cobalamin - 14/20
TPP - 2/20
FMN - 2/20
 RS: URS0002317A99_927661
MFE: -68.087
Ligand: cobalamin
Species: Cryptosporangium arvum DSM 44712 Cobalamin riboswitch
 RS: URS0000C8A879_1329909
MFE: -81.
Ligand: cobalamin
Species: Sphingobium quisquiliarum P25 Cobalamin riboswitch
 RS: URS000232C7A6_195105
MFE: -72.090
Ligand: cobalamin
Species: Haematobacter massiliensis Cobalamin riboswitch
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA058364 URS0002317A99_927661 URS0000C8A879_1329909 URS000232C7A6_195105
Length 199. 198. 198. 199.
Similarity - 0.951 0.946 0.942
Ensemble Norm 0.855 - - -
MFE -85.429 -68.087 -81. -72.090
Ligands - cobalamin cobalamin cobalamin
Gene LBR - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 17. 7. 12.004
Length SE - 1. 1. 0.
Lev Distance - 54. 67. 71.
UBS 15. 16. 14. 15.
BS 0. 0. 0. 0.
ILL 5. 3. 6. 5.
ILR 4. 5. 3. 5.
H 3. 2. 3. 2.
BL 3. 6. 3. 6.
BR 7. 6. 5. 6.
UN 0.065 0.071 0.051 0.126

Sequences

Field Description
UTR seq + 25 gaagcgccgcgaggcggggccggggaggcgcgcgcccggcuugcgggacugcggggcgcgagagcgcggccggguagcgucgcgcgcguggaucugccgccggguugcugugcgacuauucuccgggagccguccgugucaccgccggaaccuggcgcagguuaauuauagaaaATGCCAAGTAGGAAATTTGCCGATG
UTR dot + 25 …..(.((((.(((((..(((((((((((((((((((((..(((((.(((((..((((((..((((……)).)).)))))).))))).))))).)))))))….))))).))..)))))))…))))))))).)…(((((…)))))(((((((..((((…………))))..)))))))…..
RS 1 seq CUUGACGAUUGCGACCCUGAUCACCAGUGUUGAAAGGCCAUGAGCGGUGUCAGGUGGAGGAAGCCGGUGUGAAUCCGGCGCGGUCCCGCCACUGUCACCGGGGAGCGAGCCUGCAUCUUCAGCCACUGCAUCAGCGCGGGAAGGCAGCAGGGGAGUGUCGAUCCGGGAGCCAGGAGACUCCAGGUACCGCUGACCACG
RS 1 dot ……..(((((…(((((…(((((((((((((((…..(((((.((.((((.(((.(((((…….)))))….)))..)))))).)))))……).))))…..)))))).)))).))))))))))…((((((.(((((((.((…………..)).)))))…..)))))).))…
RS 2 seq GUCUUCAUUGAUCGCGCCGGUGCCCCGAAGGGGGCUUGAAUGGGAAUGCGGUGCGGAUGUCCUUUCCUUUUAGGGCGUCCAAAUCCGCGGCUGUCCCUGCAACUGUGAGCGGCGAGCGAGACACAUAUCGACCUUCCAUGACAUGGGAGGGUCAGCCACUGGGCCGGACGCUAAAUCCUGCGAGGCCUGGGAAGGCCA
RS 2 dot (((((..(((.((((.(((((((……((((((…….((..(((((…(((((((((……..)))))))))….))))).))))))))))).))).).)))))))..)))))…….((((((((……..)))))))).(((.(((((((…(((……..))).)))))))…)))..
RS 3 seq UCAUCCAUGAUCCGCUUCGGUUCCGGCAAAACCGGAUGAAAAGGGAACUGCGGUGAGCCUUCGGGCAAAACCGCGGCUGCCCCCGCAACUGUGAGCGGCGAGCGACGGCCCAGAACGUCACUGGAGGUCCGGCCUCCGGGAAGACCGGCCCGAGCGAUGACCCGUGAGCCAGGAGACCUGCCGCAGCGCUCACCCAUUU
RS 3 dot …………(((.((((..((((…..(((((…….(((.((.((((((.(.(((((((…..(((.(((((…(((….))).)))))..)))…)))).))).))))))).)).)))….)))))…..)))).)))))))…….((((((((((…))))…….))))))……

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table