Detected as a riboswitch by 8 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA058481 Similarity: 0.984 Similarity: 0.984 Similarity: 0.983
UTR: 5HSAA058481
Gene: LCOR
MFE: -15.773
ENS: 0.814
Length: 75.
Predicted Ligands:
fluoride - 8/20
cobalamin - 4/20
SAM - 3/20
RS: URS0000C23CFC_1423739
MFE: -15.395
Ligand: fluoride
Species: Lactobacillus diolivorans DSM 14421 Fluoride riboswitch
RS: URS0000AB2AD9_700597
MFE: -27.707
Ligand: cobalamin
Species: Streptomyces zinciresistens K42 Cobalamin riboswitch
RS: URS0000ABC479_553973
MFE: -14.451
Ligand: glycine
Species: Clostridium hylemonae DSM 15053 Glycine riboswitch
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA058481 URS0000C23CFC_1423739 URS0000AB2AD9_700597 URS0000ABC479_553973
Length 75. 75. 74. 76.
Similarity - 0.984 0.984 0.983
Ensemble Norm 0.814 - - -
MFE -15.773 -15.395 -27.707 -14.451
Ligands - fluoride cobalamin glycine
Gene LCOR - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 4. 7.025 4.004
Length SE - 0. 1. 1.
Lev Distance - 21. 19. 20.
UBS 4. 4. 5. 4.
BS 0. 0. 0. 0.
ILL 1. 0. 0. 1.
ILR 1. 0. 1. 0.
H 3. 3. 3. 2.
BL 0. 1. 2. 1.
BR 0. 1. 1. 1.
UN 0.360 0.347 0.203 0.421

Sequences

Field Description
UTR seq + 25 acagucccugggucuccgaccccaauauuccccuaguggcccgugagaucATGCAGCGAATGATCCAACAATTTG
UTR dot + 25 ………(((((…)))))………((….))…((..((((((…….))))))..))……
RS 1 seq UAUUAAAACGGCGAUGACGUUCGCCCUUACUCAGCAGUGUUAACACACCAAAGAGUUGAUGACGUCUACUUUAAC
RS 1 dot ………(((((……)))))………..((((….))))…(((((.(((…))).)))))…
RS 2 seq AGAGGAAGCCGGUGCGAAUCCGGCGCGGUCCCGCCACUGUCACCGGGGUAGUAACCCCCGGGAGCCAGGAACUC
RS 2 dot …….(((((…….)))))(((….)))..(((.(.((((((…….))))))..).)))……
RS 3 seq GGAUGGGACUCUGGAAAGAGCCUUUAAAGGCCACCGUAGAAGUAAAGCUUUCAGGUAAAAAUACAGAGGGUAUAGG
RS 3 dot ….(((.((((….)))))))…………………..((((((..(((….))).))))))…..

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table