Detected as a riboswitch by 20 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA058545 Similarity: 0.989 Similarity: 0.988 Similarity: 0.987
UTR: 5HSAA058545
Gene: LDHB
MFE: -7.670
ENS: 0.991
Length: 71.
Predicted Ligands:
fluoride - 20/20 - 20/20


 RS: URS0000BFF655_380358
MFE: -19.733
Ligand: fluoride
Species: Xanthomonas albilineans GPE PC73 Fluoride riboswitch
 RS: URS0000D9F052_1797841
MFE: -14.601
Ligand: fluoride
Species: Deltaproteobacteria bacterium RBG_16_50_11 Fluoride riboswitch
 RS: URS0000DA1FEF_1797971
MFE: -16.893
Ligand: fluoride
Species: Elusimicrobia bacterium RIFOXYC2_FULL_34_12 Fluoride riboswitch
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA058545 URS0000BFF655_380358 URS0000D9F052_1797841 URS0000DA1FEF_1797971
Length 71. 71. 71. 71.
Similarity - 0.989 0.988 0.987
Ensemble Norm 0.991 - - -
MFE -7.670 -19.733 -14.601 -16.893
Ligands - fluoride fluoride fluoride
Gene LDHB - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 2.002 0. 0.002
Length SE - 0. 0. 0.
Lev Distance - 15. 16. 17.
UBS 2. 3. 2. 2.
BS 0. 0. 0. 0.
ILL 0. 0. 0. 0.
ILR 0. 0. 0. 0.
H 2. 2. 2. 2.
BL 0. 0. 0. 0.
BR 0. 1. 0. 0.
UN 0.507 0.465 0.493 0.465

Sequences

Field Description
UTR seq + 25 uggacgaucuuuaccucgaauauuugaauauauugccacgugcaaaATGGCAACTCTTAAGGAAAAACTCA
UTR dot + 25 ….(((……..)))…………..((((((………))))))………………
RS 1 seq UGCGCCGCAGGAGAUGGCGUUCCUCCUUUAACCACCGUGCGAUCCGCAUGGUUGAUGACGCCUACAGCCGC
RS 1 dot .(((((((….).))))))………….((((((((…))))))))……………….
RS 2 seq UGAUCUCUUGGCGAUGAGGUUCGCCCUCAACCGUCCUAUAUUUAAGAAGGACUAAUAACUUCUACUGGAUU
RS 2 dot ………(((((……)))))…….(((((……….)))))……………….
RS 3 seq UAAUUAACUGGAGAUGGGGUUCUCCGUAAAGCGUCCCGCUUAAAAUUGGGGCUGAUGACUCCUACUUAAAC
RS 3 dot ……..((((((……))))))……((((((……..))))))……………….

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table