Detected as a riboswitch by 18 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA058547 Similarity: 0.965 Similarity: 0.962 Similarity: 0.960
UTR: 5HSAA058547
Gene: LDHC
MFE: -38.987
ENS: 0.920
Length: 137.
Predicted Ligands:
molybdenum - 8/20
cobalamin - 6/20
TPP - 2/20
 RS: URS000231DF1D_1173025
MFE: -49.621
Ligand: cobalamin
Species: Geitlerinema sp. PCC 7407 Cobalamin riboswitch
 RS: URS000231E17C_1214101
MFE: -45.611
Ligand: cobalamin
Species: Streptomyces davawensis JCM 4913 Cobalamin riboswitch
 RS: URS0000ABB3CB_431595
MFE: -43.626
Ligand: TPP
Species: Pythium ultimum DAOM BR144 TPP riboswitch (THI element)
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA058547 URS000231DF1D_1173025 URS000231E17C_1214101 URS0000ABB3CB_431595
Length 137. 137. 136. 138.
Similarity - 0.965 0.962 0.960
Ensemble Norm 0.920 - - -
MFE -38.987 -49.621 -45.611 -43.626
Ligands - cobalamin cobalamin TPP
Gene LDHC - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 8.002 15. 10.009
Length SE - 0. 1. 1.
Lev Distance - 44. 43. 48.
UBS 9. 10. 11. 10.
BS 0. 0. 0. 0.
ILL 1. 1. 3. 1.
ILR 2. 0. 4. 2.
H 3. 4. 2. 5.
BL 2. 3. 3. 3.
BR 4. 5. 3. 2.
UN 0.066 0.109 0.044 0.159

Sequences

Field Description
UTR seq + 25 cgugcgugucucgagucgcacggagggcaaccgucgacgggcuuagcgccucaacugucguugguguauuuuucuggugucacuucugugccuuccuucaaagguucuccaaATGTCAACTGTCAAGGAGCAGCTAA
UTR dot + 25 .(((((……….)))))((((((((((((.((((((((…..))))…..)))).))))…………………..))))))))……((((((((…((.(….).)).)))).))))..
RS 1 seq AAUCCGUUAAGAUAACGAGGCAAACGGAAUCACAGCAGCGUAGGGAAACUCCGGUGAGACUCCGGGGCUGUGCGGCAGCUGUAAGGAAUGGCUCUGCCGUUCCAAGCCAGAAUGCCUGCCUGCUGUCGGCCAUUCAA
RS 1 dot ..((((((…………..))))))…(((((.(((((.((…((((((…….)))))))).)))).).)))))..((((((((…))))))))……(((((((.((…..)).))).))))..
RS 2 seq AAGAUGUAUGCUCAUGCUCGCUGUCGUCGCAGGGGAAUCCGGUGUGAAUCCGGAACUGUCCCGCAACGGUGUACUUAUGCGUGUUCCGGCAUGUAUGAGCGUCAGUCCGAGGACCUGCCGACAGUGUGCCCGGCCG
RS 2 dot ..(((..((((((((((..((((((((.((.((((..(((((…….)))))….)))))).))))……………..))))..))))))))))..)))((.(((((((….))).)).))))….
RS 3 seq CGAAUCAGCGAGGGGCGCCCUCUUUGUUCCCACUGCGUGCUCGUAAGAGGAGAAGCGGAUGGGACGAAUGGCUGAGACGUUUACCCUUAGCACCUGAUCCAGAUAAUGCUGGCGGAGGGACUGCUGUGUUCAACCUUC
RS 3 dot ………(((((…)))))((((.(((((((((.(.(((….))).)…)))).)))))))))..((((((………))))))…….((((……)))).((..((((……))))..))…

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table