Detected as a riboswitch by 4 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA058553 Similarity: 0.990 Similarity: 0.990 Similarity: 0.988
UTR: 5HSAA058553
Gene: LDLRAD1
MFE: -9.496
ENS: 0.764
Length: 43.
Predicted Ligands:
SAM - 15/20
preQ_1 - 4/20
zmp-ztp - 1/20
 RS: URS0000AB27BE_945021
MFE: -5.496
Ligand: preQ_1
Species: Tetragenococcus halophilus NBRC 12172 PreQ1 riboswitch
 RS: URS000232AFD4_1797678
MFE: -15.
Ligand: zmp-ztp
Species: Clostridiales bacterium GWC2_40_7 ZMP/ZTP riboswitch
 RS: URS0000AB32D9_362948
MFE: -8.446
Ligand: preQ_1
Species: Lactobacillus salivarius UCC118 PreQ1 riboswitch
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA058553 URS0000AB27BE_945021 URS000232AFD4_1797678 URS0000AB32D9_362948
Length 43. 45. 43. 45.
Similarity - 0.990 0.990 0.988
Ensemble Norm 0.764 - - -
MFE -9.496 -5.496 -15. -8.446
Ligands - preQ_1 zmp-ztp preQ_1
Gene LDLRAD1 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 2.001 6.019 3.001
Length SE - 4. 0. 4.
Lev Distance - 9. 12. 11.
UBS 3. 2. 4. 2.
BS 0. 0. 0. 0.
ILL 1. 1. 1. 0.
ILR 1. 1. 1. 1.
H 1. 1. 1. 1.
BL 0. 0. 2. 0.
BR 1. 0. 2. 0.
UN 0.140 0.111 0. 0.111

Sequences

Field Description
UTR seq + 25 cagcaggaaaccgaagacATGCAGGGAACCCGTGCTGAGCTCT
UTR dot + 25 (((((((…((…………))…)).)))))……
RS 1 seq CUUGGACUGGUUCGCAAACUUCCCAGAAUAAAAAACCAAGAACUU
RS 1 dot (((((….((((…………))))……)))))…..
RS 2 seq GUCGUGCGACUGGCGGAAGUGGAUUAACCACAGGGAGCACGAC
RS 2 dot (((((((..((.(.((………..)).).))..)))))))
RS 3 seq CUUGGACUGGUUCGUAAACUUCCCAGUAUAAAAAACCAAGAAUCU
RS 3 dot ((((((((((…………)))))……..)))))…..

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table