Detected as a riboswitch by 12 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA058607 Similarity: 0.967 Similarity: 0.964 Similarity: 0.964
UTR: 5HSAA058607
Gene: LELP1
MFE: -25.830
ENS: 0.880
Length: 135.
Predicted Ligands:
FMN - 7/20
cobalamin - 6/20
SAM - 3/20
 RS: URS0000AB3EA7_880072
MFE: -46.917
Ligand: cobalamin
Species: Desulfobacca acetoxidans DSM 11109 Cobalamin riboswitch
 RS: URS0000C54AD3_1423731
MFE: -35.913
Ligand: FMN
Species: Lactobacillus capillatus DSM 19910 FMN riboswitch (RFN element)
 RS: URS0000DA1B4E_1897046
MFE: -30.544
Ligand: cobalamin
Species: Clostridiales bacterium 44_9 Cobalamin riboswitch
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA058607 URS0000AB3EA7_880072 URS0000C54AD3_1423731 URS0000DA1B4E_1897046
Length 135. 135. 136. 136.
Similarity - 0.967 0.964 0.964
Ensemble Norm 0.880 - - -
MFE -25.830 -46.917 -35.913 -30.544
Ligands - cobalamin FMN cobalamin
Gene LELP1 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 23.018 16.005 4.
Length SE - 0. 1. 1.
Lev Distance - 35. 41. 46.
UBS 8. 11. 9. 8.
BS 0. 0. 0. 0.
ILL 0. 3. 3. 1.
ILR 2. 3. 3. 1.
H 3. 3. 3. 4.
BL 4. 4. 3. 3.
BR 2. 4. 0. 2.
UN 0.267 0.133 0.199 0.272

Sequences

Field Description
UTR seq + 25 ggaaccaaagggaaaagccaccuucccaggcacagccauaacauccaccucacucaacugcuugucaaguucaccaccaacacagagggggcucagauaaucaagaaacaATGTCGAGTGATGATAAAAGTAAAT
UTR dot + 25 ………(((((……..))))).(((…)))…………((((((.((((.(((((.(((((.((………..)))))))..))))).))………)).))))))…………..
RS 1 seq AAGGGAACUGGGUGUGAAUCCCAGGCGGGCGCGCCGCUGUGAACGGGGACGAAGGCCGCAGGUGAGCCACUGUGGGGUAGUGCAGCUCCCAUGGGAAGGCGCGGUUGGUAGGUCGAUCCGUGAGCCAGAAGACCU
RS 1 dot …….(((((…….)))))((((…..)))).((..(((((..((…(((.(((.((.(((.(((((((((……)).)))))))…))).)).)))…))))).)))))..))……….
RS 2 seq UAGUUUCUUCGGGGCAGGGUGUAAUUCCCGACCGACGGUAACAAGCUUAGUGCUUGAAGUCCGUGACCCGCUUUGUGCGGUGGAUCUAGUGAGAAUCUAGAACCGACAGUUAAAGUCUGGAUGGGAGAAGAAAAAG
RS 2 dot ……..(((.((..(((…….)))..))..)))…(((((…..)))))..(((((.(((…..((((.((((…(((((…….)))))))))))))…..))))))))…………..
RS 3 seq UAUUACAGAAACAAUGCAUGUUCCACAGAUGUGGAUGAAAAGGGAAACCGGUGUGAAUCCAGUACGGUCCCGCCACUGUAAAAGGGAGCUAUUAUCAUAUAUGUCACUGCCGAAAUGGCGGGAAGACGAUAAAAUG
RS 3 dot …………………(((((….)))))……((….)).((((((….((((.(.((((…………)))).))))).)))))).((((.(((((…..)))))…))))……..

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table