Detected as a riboswitch by 13 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA058691 Similarity: 0.964 Similarity: 0.964 Similarity: 0.964
UTR: 5HSAA058691
Gene: LGALS2
MFE: -37.789
ENS: 0.881
Length: 137.
Predicted Ligands:
cobalamin - 10/20
FMN - 9/20
TPP - 1/20
 RS: URS00019FC4BE_2653126
MFE: -49.695
Ligand: FMN
Species: Aeromicrobium sp. 9AM FMN
 RS: URS0000C04A4A_698760
MFE: -53.273
Ligand: FMN
Species: Streptomyces turgidiscabies Car8 FMN riboswitch (RFN element)
 RS: URS0000C5CDF2_1736516
MFE: -58.804
Ligand: FMN
Species: Yonghaparkia sp. Root332 FMN riboswitch (RFN element)
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA058691 URS00019FC4BE_2653126 URS0000C04A4A_698760 URS0000C5CDF2_1736516
Length 137. 138. 136. 137.
Similarity - 0.964 0.964 0.964
Ensemble Norm 0.881 - - -
MFE -37.789 -49.695 -53.273 -58.804
Ligands - FMN FMN FMN
Gene LGALS2 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 4. 3.005 3.005
Length SE - 1. 1. 0.
Lev Distance - 45. 46. 48.
UBS 9. 10. 8. 8.
BS 2. 1. 2. 1.
ILL 2. 3. 1. 2.
ILR 1. 1. 1. 1.
H 3. 3. 3. 3.
BL 4. 4. 5. 4.
BR 4. 3. 4. 3.
UN 0.124 0.116 0.051 0.051

Sequences

Field Description
UTR seq + 25 gaccuugagggaguuaauguguaauauucuaggauauaagcuugaccacgaguugagacccugagcacaggccuccaggagccgcugggagcugccgccaggagcugucaccATGACGGGGGAACTTGAGGTTAAGA
UTR dot + 25 ..(((..((((.((((…..)))).)))))))…….(((((((.((((((….(((((.((…(((.(((((……))))).)))…)))))).)((((((…))))))…)))))).))))))).
RS 1 seq CGCGUGCUCCGGGGUCGGUGUAAUUCCGAGCCGGCGGUGACAGUCCGCGACCCGCGGUCCCAUCCUCGUGAUGAGACUUCGGUUGAGCCGGUGAAAUUCCGGCACCGACGGUGAAAGUCCGGAAGGGAGGAGCAUGAG
RS 1 dot ..((((((((.((.((((…….)))).))…………(((((…)))))((((.(((..(.(((…((((((((…(((((…….)))))))))).)))….))))))).))))))))))))..
RS 2 seq CAGCGCACUCCGGGGUCGGUGAAAGUCCGAACCGGCGGUUACAGUCCGCGACCCGUCCGUAUUUUUUUCUGCGGCCGGUUGACCAGGUGGAAUUCCUGGACCGACGGUUAAAGUCCGGAUGGGAGGCAGUGCGCGG
RS 2 dot ..(((((((((.((.((((…….)))).)).((((…….))))..((((((((.(((((…….((((.((((.(((((…….)))))..))))))))))))).)))))))).)).)))))))..
RS 3 seq AACGCACUUCGGGGUCGGUGAAAGUCCGAGCCGGCGGUCAUAGUCCGCGACCCGUGGUCGAGCUCUCGGGCUCGGCACCGGUUGAGCUGGUGGAACUCCAGCACCGACGGUGAGAGUCCGGAUGGGAGAAGUGCGGU
RS 3 dot ..((((((((.((.((((…….)))).)).((((…….))))..(((((……….((((((((..((((.((((.(((((…….)))))..)))))))).))))))))))))).))))))))..

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table