Detected as a riboswitch by 13 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA058734 Similarity: 0.967 Similarity: 0.964 Similarity: 0.962
UTR: 5HSAA058734
Gene: LGALS8
MFE: -25.339
ENS: 0.896
Length: 150.
Predicted Ligands:
glucosamine - 12/20
FMN - 7/20
cobalamin - 1/20
 RS: URS0000D9360E_1895746
MFE: -36.181
Ligand: glucosamine
Species: Clostridiales bacterium 38-18 glmS glucosamine-6-phosphate activated ribozyme
 RS: URS0000BEF2D4_1048380
MFE: -37.931
Ligand: glucosamine
Species: Fusibacter sp. 3-D3-R-P8ASC2010 glmS glucosamine-6-phosphate activated ribozyme
 RS: URS0000D80A73_1255619
MFE: -24.653
Ligand: cobalamin
Species: Vagococcus fluvialis bH819 AdoCbl riboswitch
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA058734 URS0000D9360E_1895746 URS0000BEF2D4_1048380 URS0000D80A73_1255619
Length 150. 149. 148. 149.
Similarity - 0.967 0.964 0.962
Ensemble Norm 0.896 - - -
MFE -25.339 -36.181 -37.931 -24.653
Ligands - glucosamine glucosamine cobalamin
Gene LGALS8 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 7.016 7.015 2.014
Length SE - 1. 4. 1.
Lev Distance - 41. 40. 49.
UBS 7. 8. 8. 7.
BS 0. 0. 0. 0.
ILL 1. 2. 2. 2.
ILR 2. 4. 4. 2.
H 5. 4. 4. 5.
BL 1. 1. 1. 0.
BR 0. 0. 0. 0.
UN 0.333 0.208 0.209 0.215

Sequences

Field Description
UTR seq + 25 augauccuguagaacuucggagggccagugccucaguuucaauccagguaaccuuuaaaugaaacuugccuaaaaucuuaggucauacacagaagagacuccaaucgacaagaagcuggaaaagaATGATGTTGTCCTTAAACAACCTAC
UTR dot + 25 ……………….((((…….))))(((((((….(((…)))…..))))))).((((((….))))))…………….((((.((…..))…))))……….(((((……)))))….
RS 1 seq AAUUGAAUAUAAGCGCCAGAACUGUUUUACAGUUGACGAGGGUGGGGUUAAUCGAAAAUUCGGCGGGUGCCCCACGGUGUAAUCAACACCGGAAAUGUCAUACAAAACCAUAAAGUGAUUUGUGGAACAAAGUUGACAGGUUGAUUCAA
RS 1 dot ……………((.(((((((…))))))..)..))(((((((…((((….))))…..)))))))(((((…..)))))…..(((((…….(((((((….)))))))……..)))))………..
RS 2 seq AACUUAAUACAAGCGCCAGAACUGUUUACAGUUGACGAGGGCGGGGUUAAUCGAAAAUUCGGCGGGUGCCCCGCGGUGUAAUCAACACCGUAAAUACCAUACAAAUUUCCAGAGUGAUUUGGAAGACAAAGUUGGUAGGUUGAUUUAA
RS 2 dot ……………((.((((((….)))))..)..))(((((((…((((….))))…..)))))))(((((…..)))))…..(((((……((((((((….))))))))…….)))))………..
RS 3 seq CAUAGAUUAAAAUUUUCCUCUCUAAAUGGAACUUUGGUGAAAAUCCAAGACGGUCCCGCCACUGUAAUAAGCAUAAUGCUUUAAGUCAGGUCUUUUUAGAAAGUUAAAAAUUGGUACUUACUGUUUCGUGGUAGAACAGUGGGAGUUAG
RS 3 dot …………..((((………))))…(((((…..((…..))…)))))(((….(((((…)))))…..)))…(((((((….)))))))……((((((((((…….))))))))))……

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table